SEARCH · PubMed Health

Results for “regulatory element transcripts”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,459 records · Page 81Linked to original sources

PubMed1996

Transcriptional regulation of the human iNOS gene in vascular-smooth-muscle cells and macrophages: evidence for tissue specificity.

We have cloned the 5' upstream -1034 to +88 fragment of the human inducible nitric oxide synthase (hiNOS) gene and demonstrate its competence to promote luciferase gene transcription in vascular-smooth-muscle (VSM) cells and macrophages. Sequential 5' end-deletions localized positive regulatory elements of hiNOS transcription in VSM A7r5 cells downstream of nucleotide -205 and demonstrated the functional importance of the resident NF-kappaB site (nucleotides -115 to -106). The hiNOS promoter/enhancer was induced strongly by LPS and IFN-gamma, and modestly by IL-1beta in RAW 264.7 cells, but not in VSM cells. Truncation of the NF-kappaB site markedly diminished, but did not eliminate, LPS-inducibility. Sodium salicylate and ibuprofen down-regulated the basal transcriptional activity of the hiNOS promoter/enhancer in VSM but not in RAW 264.7 cells. These results indicate that the transcriptional regulation of the hiNOS gene features considerable complexity and tissue specificity.

Animals↗

PubMed1995

Identification of a negative cis-regulatory element and trans-acting protein that inhibit transcription of the angiotensin II type 1a receptor gene.

The rat angiotensin II type 1a receptor (AT1a-R) gene is expressed in a cell-specific manner. We demonstrated that the negative regulatory element (NRE) between -489 and -331 is active in PC12 cells (Murasawa, S., Matsubara, H., Urakami, M., and Inada, M. (1993) J. Biol. Chem. 268, 26996-27003). Gel retardation assays confirmed that PC12 cells have a trans-acting factor bound to the NRE. By means of a DNase I footprint assay we identified the core of the NRE as an (A+T)-rich sequence (TAATCTTTTATTTTA) located at nucleotides -456 to -442. Oligonucleotides corresponding to the NRE core sequence bound to nuclear protein. Site-directed mutagenesis at nucleotides -451 to -448 eliminated the specific protein/DNA binding and restored expression of the AT1a-R in transient transfection assays (2.7-fold increase). The NRE did not negatively affect the thymidine kinase promoter. No homology was found with known NREs, suggesting that this is a novel NRE. Southwestern blotting revealed a 53-kDa, specific binding protein in PC12 cells and the rat brain, but not in the liver, spleen, adrenal gland, and kidney. These findings demonstrate that the NRE of the rat AT1a-R is an (A+T)-rich sequence located at nucleotides -456 to -442 and the 53-kDa protein is a specific binding protein, and suggest that this protein may be a trans-acting factor which determines the neuron-specific down-regulation of the AT1a-R gene.

Angiotensin II↗

PubMed2006

Complementation rescue of Pdx1 null phenotype demonstrates distinct roles of proximal and distal cis-regulatory sequences in pancreatic and duodenal expression.

The unique, well-demarcated expression domain of Pdx1 within the posterior foregut suggests that investigating its transcriptional regulation will provide insight into mechanisms that regionally pattern the endoderm. Previous phylogenetic comparison identified conserved noncoding regions that stimulate transcriptional activity selectively in cultured pancreatic beta cells. Characterization of these regulatory elements is helping to dissect the transcription factor networks that operate within beta cells, which is important for understanding the etiology of beta cell dysfunction and diabetes, as well as for developing methods to produce beta cells in vitro for cell-based therapies. We recently reported that deletion of three proximally located conserved areas (Area I-II-III) from the endogenous Pdx1 locus resulted in severely reduced expression of Pdx1 in the pancreas, and a milder decrease in other foregut tissues. Here, we report transgene-based complementation experiments on Pdx1 null mice, which reveal that the proximal promoter/enhancer region, including Area I-II-III, rescues the pancreatic defects caused by Pdx1 deficiency, but only weakly promotes expression of Pdx1 in the postnatal stomach and duodenum. These results reveal a role for distal cis-regulatory elements in achieving the correct level of extra-pancreatic Pdx1 expression, which is necessary for the production of duodenal GIP cells and stomach gastrin cells.

Animals↗

PubMed2005

PRECISE: software for prediction of cis-acting regulatory elements.

The regulation of gene expression at the transcription initiation level is highly complex and requires the presence of multiple transcription factors. These transcription factors are often proteins or peptides that bind to the so-called cis-acting elements, which are present in the promoter regions and conserved among different species. In order to predict these cis-acting elements, a computer program called PRECISE (Prediction of REgulatory CIS-acting Elements) was developed. The power of the tool lies in its user-friendly interface and in the possibility of using empirical motif frequency tables to filter through the many discovered motifs. The tools to create the empirical motif frequency table (e.g., from a whole genome sequence) are included in the package. In the first case study, the upstream regions of all the genes in the Arabidopsis genome were used to create an empirical motif frequency table and a set of 64 upstream sequences of genes known to be involved in starch metabolism was subjected to analysis by PRECISE. The 20 motifs with the highest specificity in the selected set were analyzed in more detail. Of these 20 motifs, 15 showed a very high or complete homology to the sequences of known cis-acting elements. These cis-acting elements are regulated by light, auxin, and abscisic acid, and confer specific expression in sink organs such as leaves and seeds. All these factors have been shown to play an important role in starch biosynthesis. In the second case study, the upstream regions of 16 genes whose transcription is induced by gibberellins (GA) in Arabidopsis were analyzed with PRECISE and compared to the motifs present in the PLACE database. Among the most promising motifs found by PRECISE were 6 of the 17 known GA motifs. These results indicate the power of the PRECISE software package in the prediction of regulatory elements.

Algorithms↗

PubMed2000

Molecular characterization of human acetyl-CoA synthetase, an enzyme regulated by sterol regulatory element-binding proteins.

Through suppressive subtractive hybridization, we identified a new gene whose transcription is induced by sterol regulatory element-binding proteins (SREBPs). The gene encodes acetyl-CoA synthetase (ACS), the cytosolic enzyme that activates acetate so that it can be used for lipid synthesis or for energy generation. ACS genes were isolated previously from yeast, but not from animal cells. Recombinant human ACS was produced by expressing the cloned cDNA transiently in human cells. After purification by nickel chromatography, the 701-amino acid cytosolic enzyme was shown to function as a monomer. The recombinant enzyme produced acetyl-CoA from acetate in a reaction that required ATP. As expected for a gene controlled by SREBPs, ACS mRNA was induced when cultured cells were deprived of sterols and repressed by sterol addition. The pattern of regulation resembled the regulation of enzymes of fatty acid synthesis. ACS mRNA was also elevated in livers of transgenic mice that express dominant-positive versions of all three isoforms of SREBP. We conclude that ACS mRNA, and hence the ability of cells to activate acetate, is regulated by SREBPs in parallel with fatty acid synthesis in animal cells.

Acetate-CoA Ligase↗

PubMed2002

Proteolysis and sterol regulation.

The mammalian cell continuously adjusts its sterol content by regulating levels of key sterol synthetic enzymes and levels of LDL receptors that mediate uptake of cholesterol-laden particles. Control is brought about by sterol-regulated transcription of relevant genes and by regulated degradation of the committed step enzyme HMG-CoA reductase (HMGR). Current work has revealed that proteolysis is at the heart of each of these mechanistically distinct axes. Transcriptional control is effected by regulated cleavage of the membrane-bound transcription factor sterol regulatory element binding protein (SREBP), and HMGR degradation is brought about by ubiquitin-mediated degradation. In each case, ongoing cell biological processes are being harnessed to bring about regulation. The secretory pathway plays a central role in allowing sterol-mediated control of transcription. The constitutively active endoplasmic reticulum (ER) quality control apparatus is employed to bring about regulated destruction of HMGR. This review describes the methods and results of various studies to understand the mechanisms and molecules involved in these distinct but interrelated aspects of sterol regulation and the intriguing similarities that appear to exist at the levels of protein sequence and cell biology.

Animals↗

PubMed2006

Hepatic PCSK9 expression is regulated by nutritional status via insulin and sterol regulatory element-binding protein 1c.

Familial autosomal dominant hypercholesterolemia is associated with high risk for cardiovascular accidents and is related to mutations in the low density lipoprotein receptor or its ligand apolipoprotein B (apoB). Mutations in a third gene, proprotein convertase subtilisin kexin 9 (PCSK9), were recently associated to this disease. PCSK9 acts as a natural inhibitor of the low density lipoprotein receptor pathway, and both genes are regulated by depletion of cholesterol cell content and statins, via sterol regulatory element-binding protein (SREBP). Here we investigated the regulation of PCSK9 gene expression during nutritional changes. We showed that PCSK9 mRNA quantity is decreased by 73% in mice after 24 h of fasting, leading to a 2-fold decrease in protein level. In contrast PCSK9 expression was restored upon high carbohydrate refeeding. PCSK9 mRNA increased by 4-5-fold in presence of insulin in rodent primary hepatocytes, whereas glucose had no effect. Moreover, insulin up-regulated hepatic PCSK9 expression in vivo during a hyperinsulinemic-euglycemic clamp in mice. Adenoviral mediated overexpression of a dominant or negative form of SREBP-1c confirmed the implication of this transcription factor in insulin-mediated stimulation of PCSK9 expression. Liver X receptor agonist T0901317 also regulated PCSK9 expression via this same pathway (a 2-fold increase in PCSK9 mRNA of primary hepatocytes cultured for 24 h in presence of 1 microm T0901317). As our last investigation, we isolated PCSK9 proximal promoter and verified the functionality of a SREBP-1c responsive element located from 335 bp to 355 bp upstream of the ATG. Together, these results show that PCSK9 expression is regulated by nutritional status and insulinemia.

Animals↗

PubMed1997

Gene structure of the rat kainate receptor subunit KA2 and characterization of an intronic negative regulatory region.

We have isolated and analyzed the structure of the gene grik5 (glutamate receptor ionotropic kainate 5), encoding the rat kainate receptor subunit KA2. Six overlapping DNA fragments containing the entire grik5 gene were identified in a rat genomic library. grik5 is a unique gene composed of 20 exons that together span over 54 kilobases (kb). Reporter gene analysis demonstrated that 2 kb of grik5 5'-flanking sequence confers tissue-specific expression on a chloramphenicol acetyltransferase gene in vitro. We show that (i) the first intron of grik5 (3.4 kb) inhibited transcription of the chloramphenicol acetyltransferase gene driven by the 2-kb grik5 5'-flanking region; (ii) the negative regulatory element was located within 500 bp of the 3'-end of intron 1, and this 500-bp fragment selectively bound nuclear proteins isolated from neural and nonneural cells; (iii) the effect of the negative regulatory element on grik5 transcription was orientation- and distance-independent; and (iv) a 24-nucleotide sequence (CTTTCTGTGGCCTCTGACCTTTCC) was identified as the binding site for nuclear proteins within the 500-bp fragment, as determined by footprinting and gel shift assays. We conclude that an intronic element that displays features of a silencer modulates grik5 transcription.

Animals↗

PubMed1997

Activation of transcription of the melanoma inducing Xmrk oncogene by a GC box element.

Melanoma formation in Xiphophorus is caused by overexpression of the Xmrk gene. The promoter region of the Xmrk oncogene differs strikingly from the corresponding proto-oncogenic sequences and was acquired in the course of a nonhomologous recombination with another gene locus, D. In order to identify regulatory elements leading to the strong transcriptional activation of Xmrk in melanoma tissue and to contribute to an understanding of the role the regulatory locus R might play in suppressing the tumor phenotype in wild-type Xiphophorus, we performed functional analysis of the Xmrk oncogene promoter. Transient transfections in melanoma and nonmelanoma cells revealed the existence of a potent positive regulatory element positioned close to the transcriptional start site. Contained within this promoter segment is a GC-rich sequence identical to the binding site described for human Sp1. In vitro binding studies and biochemical characterizations demonstrated the existence of GC-binding proteins in fish that share immunological properties with members of the human Sp family of transcription factors and appear to be involved in the high transcriptional activation of the Xmrk oncogene. Since the identified cis element is functional in both melanoma and nonmelanoma cells, additional silencer elements suppressing Xmrk expression in nonpigment cells must exist, thereby suggesting a negative regulatory function for the genetically defined R locus.

Animals↗

PubMed2005

Transcriptional regulation of phagocytosis-induced membrane biogenesis by sterol regulatory element binding proteins.

In the process of membrane biogenesis several dozen proteins must operate in precise concert to generate approximately 100 lipids at appropriate concentrations. To study the regulation of bilayer assembly in a cell cycle-independent manner, we have exploited the fact that phagocytes replenish membranes expended during particle engulfment in a rapid phase of lipid synthesis. In response to phagocytosis of latex beads, human embryonic kidney 293 cells synthesized cholesterol and phospholipids at amounts equivalent to the surface area of the internalized particles. Lipid synthesis was accompanied by increased transcription of several lipogenic proteins, including the low-density lipoprotein receptor, enzymes required for cholesterol synthesis (3-hydroxy-3-methylglutaryl CoA synthase, 3-hydroxy-3-methylglutaryl CoA reductase), and fatty acid synthase. Phagocytosis triggered the proteolytic activation of two lipogenic transcription factors, sterol regulatory element binding protein-1a (SREBP-1a) and SREBP-2. Proteolysis of SREBPs coincided with the appearance of their transcriptionally active N termini in the nucleus and 3-fold activation of an SREBP-specific reporter gene. In previous studies with cultured cells, proteolytic activation of SREBP-1a and SREBP-2 has been observed in response to selective starvation of cells for cholesterol and unsaturated fatty acids. However, under the current conditions, SREBP-1a and SREBP-2 are induced without lipid deprivation. SREBP activation is inhibited by high levels of the SREBP-interacting proteins Insig1 or the cytosolic domain of SREBP cleavage-activating protein. Upon overexpression of these proteins, phagocytosis-induced transcription and lipid synthesis were blocked. These results identify SREBPs as essential regulators of membrane biogenesis and provide a useful system for further studies on membrane homeostasis.

CCAAT-Enhancer-Binding Proteins↗

PubMed2006

Increased p53 transcription prior to DNA synthesis is regulated through a novel regulatory element within the p53 promoter.

p53 mRNA levels are tightly regulated during the cell cycle with its transcription being induced prior to DNA synthesis. However, the mechanism controlling this regulation is not well defined. Through characterizing an additional 1000 bp of upstream DNA sequences of the murine p53 gene, we identified new positive and negative regulatory elements. Furthermore, we found a trans-acting factor(s) that binds within a positive cis-acting element (-972/-953) in a manner indicative of regulation during the cell cycle. When Swiss3T3 cells are arrested by serum depletion p53 mRNA levels decrease and binding of this regulatory factor(s) to the promoter is reduced. Upon serum stimulation, the regulatory factor(s) binds the promoter and p53 mRNA levels increase prior to the cells entering S phase. When the factors are experimentally sequestered from the promoter or when the regulatory element is deleted from the promoter, p53 promoter activity is reduced. There is no further reduction in p53 promoter activity upon serum depletion and the kinetics of induction upon serum stimulation is delayed by approximately 5 h. These findings indicate that a factor(s) binding within the -972/-953 regulatory element on the p53 promoter is important for the proper regulation of p53 mRNA expression in response to mitogen stimulation. Our initial findings indicate that a member of the C/EBP family of transcription factors may play a role in this regulation.

3T3 Cells↗

PubMed2006

Insulin induction of glucokinase and fatty acid synthase in hepatocytes: analysis of the roles of sterol-regulatory-element-binding protein-1c and liver X receptor.

The transcription activator SREBP-1c (sterol-regulatory-element-binding protein-1c) is induced by insulin in the liver and is considered a master regulator of lipogenic genes such as FASN (fatty acid synthase). The question of whether SREBP-1c is also a mediator of insulin action on the regulatory enzyme of glucose metabolism GCK (glucokinase) is controversial. In the present paper, we induced SREBP-1c to various levels with insulin or the liver X receptor ligand T0901317 in primary hepatocytes and asked if these levels correlated with those of GCK or FASN mRNA expression, using the latter as positive control. Insulin and T0901317 triggered the accumulation of precursor and processed forms of SREBP-1c to similar levels and with comparable kinetics, and both effectors together caused synergistic increases in SREBP-1c protein levels. These effects were accompanied by commensurate elevation of FASN mRNA, notably by a synergistic response to both effectors. By contrast, GCK mRNA was unresponsive to T0901317 and was induced only by insulin. Treatment of hepatocytes with insulin and/or T0901317 resulted in the recruitment of SREBP-1c to the FASN promoter as shown by chromatin immunoprecipitation, whereas SREBP-1c did not bind to the GCK promoter. Lastly, we observed that the glycogen synthase kinase-3 inhibitor SB216763 produced a small increase in SREBP-1c protein level, which was further augmented in the presence of T0901317. The level of FASN mRNA varied in parallel with SREBP-1c, while GCK mRNA was unaffected. Collectively, these results showed that increases in SREBP-1c were neither necessary nor sufficient for GCK induction in hepatocytes, while at the same time they underscored the role of SREBP-1c as a key regulator of FASN.

Animals↗

PubMed1999

In vivo analysis of plastid psbA, rbcL and rpl32 UTR elements by chloroplast transformation: tobacco plastid gene expression is controlled by modulation of transcript levels and translation efficiency

5' and 3' untranslated regions (UTRs) of plastid RNAs act as regulatory elements for post-transcriptional control of gene expression. Polyethylene glycol-mediated plastid transformation with UTR-GUS reporter gene fusions was used to study the function of the psbA, rbcL and rpl32 UTRs in vivo. All gene fusions were expressed from the same promoter, i.e. the promoter of the 16S-rRNA gene, such that variations in RNA and protein levels would be due to the involved UTR elements alone. Transgenic tobacco lines containing different combinations of UTRs showed fivefold variation in the uidA-mRNA level (RNA stability) and approximately 100-fold differences in GUS activity, a measure of translation activity. The rbcL 5'-UTR conferred greater mRNA stability than the psbA 5'-UTR on uidA transcripts. In contrast, the psbA 5'-UTR enhanced translation of GUS to a much greater extent compared to the rbcL 5'-UTR. The psbA 5'-UTR also mediated light-induced activation of translation which was not observed with other constructs. Deletion mutagenesis of an unanalysed terminal sequence element of the psbA 5'-UTR resulted in a twofold drop in uidA-mRNA level and a fourfold decrease in translation efficiency. Exchange of 3'-UTRs results in up to fivefold changes of mRNA levels and does not significantly influence translation efficiency. The mechanical impacts of these results on plastid translation regulation are discussed.

Journal Article↗

PubMed1995

Characterization of the promoter region of the human transforming growth factor-beta type II receptor gene.

Diminished cellular responsiveness to transforming growth factor-beta (TGF-beta) is frequently correlated with decreased transcription of the type II receptor for TGF-beta (TGF-beta RII). We have cloned and characterized the human TGF-beta RII promoter and, using S1 nuclease mapping and 5' rapid amplification of cDNA ends polymerase chain reaction, have identified five alternative transcription start sites within the region -33 to +57. DNA transfection experiments and electrophoretic mobility shift assays have revealed the existence of five distinct regulatory regions including two positive regulatory elements and two negative regulatory elements in addition to the core promoter region. The first positive regulatory element (-219 to -172) interacts with two distinct nuclear protein complexes, at least one of which appears to be a previously unidentified transcription factor. The second positive regulatory element (+1 to +35) also interacts with two separate protein complexes, both of which appear to be novel transcription factors. Deletion of either positive regulatory element markedly decreased expression of the target gene, suggesting that both positive regulatory elements are necessary for basal expression levels of TGF-beta RII.

Base Sequence↗

PubMed1992

The functional importance of a cap site-proximal region of the human prointerleukin 1 beta gene is defined by viral protein trans-activation.

Prointerleukin 1 beta (IL-1 beta) is a cytokine that mediates a broad range of biological activities. Genomic sequences that regulate IL-1 beta transcription include both inducible regulatory elements located more than 2,700 bp upstream of the transcriptional start site (cap site) and proximal elements located near the TATA box of this gene. In this study, we focused on the identification and characterization of trans-acting nuclear regulatory proteins that bind to the cap site-proximal region of the human IL-1 beta gene. We identified a protein, termed NFIL-1 beta A (NF beta A), that binds to a highly conserved 12-bp DNA sequence (-49 to -38) located upstream of the TATA box motif in both the human and murine IL-1 beta genes. The IL-1 alpha gene, which lacks a TATA motif, does not possess an NF beta A-binding sequence within the promoter region, suggesting that NF beta A may selectively regulate IL-1 beta expression. Using electrophoretic mobility shift assays, we identified several distinct DNA-protein complexes that are expressed in a cell-type-specific manner. In monocytic cell lines, the relative abundance of these complexes varies rapidly following stimulation of the cells with phorbol esters or lipopolysaccharide. UV cross-linking analysis identified two distinct DNA-binding polypeptides that comprise distinct complexes. The functional role of NF beta A was assessed in transient transfection assays. These data indicate that NF beta A is required for both basal and inducible promoter activity in monocytic cells. Furthermore, the human cytomegalovirus immediate-early 1 gene product requires the presence of NF beta A in order to trans-activate the proximal IL-1 beta promoter in a monocytic cell line. We propose that NF beta A is a factor that mediates either direct or indirect activation by the immediate-early 1 gene product. The proximity of this essential factor to the TATA motif suggests a possible role in transcriptional initiation.

Animals↗

PubMed1993

Structural organization of the gene encoding the rat pancreatitis-associated protein. Analysis of its evolutionary history reveals an ancient divergence from the other carbohydrate-recognition domain-containing genes.

Rat pancreatitis-associated protein (PAP) mRNA is barely detectable in normal pancreas and overexpressed during acute pancreatitis (Iovanna, J., Orelle, B., Keim, V., and Dagorn J.-C. (1991) J. Biol. Chem. 266, 24664-24669). RNA amplification by reverse-transcriptase-coupled polymerase chain reaction showed that PAP mRNA was constitutively expressed in duodenum, jejunum, and ileum, at similar levels as in pancreas during the acute phase of pancreatitis. A weak expression was also detected in several other tissues. The rat PAP gene was isolated from a genomic library and characterized over 3.2 kilobases of gene sequence and 1.2 kilobases of 5'-flanking sequence. The 5' end of the coding sequence was determined by primer extension of the PAP transcript. Several potential regulatory elements were identified in the promoter region, including a pancreas-specific consensus sequence, two Pan1 (pancreas-specific) transcription activators, two IL-6 response elements, and one glucocorticoid response element. The PAP coding sequence spanned over six exons. The first three exons encoded the 5'-untranslated region of the mRNA, the signal peptide, and 39 amino acids of the NH2-terminal end of the mature protein, respectively. The other three exons encoded a domain of the protein with significant homology to the carbohydrate-recognition domain of animal lectins. Sequence comparison of the PAP gene with 13 carbohydrate-recognition domain-containing genes revealed that they derived from the same ancestor gene. Position of introns within the carbohydrate-recognition domain were different, however, suggesting that PAP belongs to a new group of lectins. These results support the hypothesis that genes encoding PAP and other lectins evolved from a common ancestor gene by intron gain.

Acute Disease↗

PubMed1992

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites.

Animals↗

PubMed1999

Sterol regulatory element-binding protein negatively regulates microsomal triglyceride transfer protein gene transcription.

We herein report that mRNA expression of microsomal triglyceride transfer protein (MTP) and its protein synthesis decline in response to sterol depletion in HepG2 cells, and we functionally characterized the MTP gene promoter in an effort to investigate the molecular mechanisms by which MTP gene transcription is regulated. Luciferase assays using truncated versions of the reporter gene revealed that the region at -124 to +33 base pairs of the human promoter contains the elements required for the suppression of transcription by sterol depletion. Enforced expression of an active form of sterol regulatory element-binding protein (SREBP)-1 (amino acids 1-487) or -2 (amino acids 1-481), both of which are activated under sterol-depleted conditions, is able to mimic sterol-mediated down-regulation. Either further truncation of the promoter region or mutation of the putative SREBP-binding sequence (5'-GCAGCCCAC-3', -124 to -116 base pairs) abolishes the sterol- and SREBP-dependent transcriptional regulation. Gel mobility shift assay showed that recombinant SREBP-2-(1-481) is able to bind the sequence. Enforced expression of a truncated form of SREBP-2 (amino acids 31-481), which acts as an inhibitor of transcription of the low density lipoprotein receptor gene because it lacks the transcriptional activation domain, also diminishes the luciferase activity, suggesting that direct binding to the promoter region might be sufficient and that the mechanism by which SREBPs inhibit MTP gene expression is distinct from that for the transcriptional stimulation of sterol-regulated genes. Although the SREBP-binding site overlaps a negative insulin-responsive element, insulin negatively regulates MTP gene expression even when the amount of the active form of SREBPs is quite low under the sterol-loaded conditions, indicating that SREBPs only slightly mediate, if at all, the insulin effects. Overall, we conclude that SREBPs are responsible for regulation of lipoprotein secretion via their control of MTP gene expression. Moreover, our results describe for the first time a novel mechanism by which SREBPs negatively regulate expression of the gene encoding the protein involved in lipid metabolism.

Base Sequence↗