PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Inovirus”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 163 records · Page 9Linked to original sources
PubMed2001

SELEX selection of high-affinity oligonucleotides for bacteriophage Ff gene 5 protein.

The Ff gene 5 protein (g5p) is a cooperative ssDNA-binding protein. SELEX was used to identify DNA sequences favorable for g5p binding at physiological ionic strength (200 mM NaCl) and 37 degrees C. Sequences were selected from a library of 58-mers that contained a central variable segment of 26 nucleotides. DNA sequences selected after eight rounds of SELEX were mostly G-rich, with multiple copies of CPuGGPy, TPuGGGPy, and/or PyPuPuGGGPy motifs. This was unexpected, since g5p has higher binding affinities for polypyrimidine than for polypurine sequences. The most recurrent G-rich sequence, named I-3, was found to have g5p-binding properties that were correlated with a structural transition. At 10 mM NaCl, I-3 existed in a single-stranded form that was saturated by g5p in an all-or-none fashion. At 200 mM NaCl, I-3 existed in a structured form that showed CD spectral features of G-quadruplexes. The g5p binding affinity for this structured form of I-3 was >100-fold higher than for the single-stranded form. Moreover, the structured I-3 was saturated by g5p in two steps, the first of which was the formation of an apparent initiation complex consisting of one I-3 strand and about three g5p dimers. Nuclease S1 footprinting and other experiments showed that g5p molecules in the initiation complex at 200 mM NaCl were bound directly to the G-rich variable segment and that the structure of I-3 was retained after saturation by g5p. Thus, G-rich motifs may form structures favorable for initiation of g5p binding and also provide the actual g5p-binding sites.

Bacteriophage M13↗
PubMed2004

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin.

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.

Base Sequence↗
PubMed2004

A positive charge at position 33 of thioredoxin primarily affects its interaction with other proteins but not redox potential.

Oxidoreductases of the thioredoxin superfamily possess the C-X-X-C motif. The redox potentials vary over a wide range for these proteins. A crucial determinant of the redox potential has been attributed to the variation of the X-X dipeptide. Here, we substitute Lys for Gly at the first X of Escherichia coli thioredoxin to investigate how a positive charge would affect the redox potential. The substitution does not affect the protein's redox potential. The equilibrium constant obtained from pairwise reaction between the mutant and wild-type proteins equals 1.1, indicating that the replacement does not significantly affect the thiol-disulfide redox equilibrium. However, the catalytic efficiency of thioredoxin reductase on the G33K mutant decreases approximately 2.8 times compared to that of the wild type. The mutation mainly affects K(m), with little effect on k(cat). The mutation also inhibits thioredoxin's ability to reduce insulin disulfide by approximately one-half. Whether the mutant protein supports the growth of phages T3/7 and f1 was tested. The efficiency of plating (EOP) of T3/7 on the mutant strain decreases 5 times at 37 degrees C and 3 x 10(4) times at 42 degrees C relative to that of the wild-type strain, suggesting that interaction between phage gene 5 protein and thioredoxin is hindered. The mutation also reduces the EOP of phage f1 by 8-fold at 37 degrees C and 1.5-fold at 42 degrees C. The global structure of the mutant protein does not change when studied by CD and fluorescence spectra. Therefore, G33K does not significantly affect the overall structure or redox potential of thioredoxin, but primarily interferes with its interaction with other proteins. Together with the G33D mutation, the overall results show that a charged residue at the first X has a greater influence on the molecular interaction of the protein than the redox potential.

Amino Acid Substitution↗
PubMed2004

Inhibiting aggregation of alpha-synuclein with human single chain antibody fragments.

The alpha-synuclein protein has been strongly correlated with Parkinson's disease (PD) and is a major component of the hallmark Lewy body aggregates associated with PD. Two different mutations in the alpha-synuclein gene as well as increased gene dosage of wild-type alpha-synuclein all associate with early onset cases of PD; and transgenic animal models overexpressing alpha-synuclein develop PD symptoms. Alpha-synuclein, a natively unfolded protein, can adopt a number of different folded conformations including a beta-sheet form that facilitates formation of numerous aggregated morphologies, including long fibrils, spherical and linear protofibrils, and smaller aggregates or oligomers. The roles of the various morphologies of alpha-synuclein in the progression of PD are not known, and different species have been shown to be toxic. Here we show that single chain antibody fragments (scFv's) isolated from naïve phage display antibody libraries can be used to control the aggregation of alpha-synuclein. We isolated an scFv with nanomolar affinity for monomeric alpha-synuclein (K(D) = 2.5 x 10(-8) M). When co-incubated with monomeric alpha-synuclein, the scFv decreased not only the rate of aggregation of alpha-synuclein, but also inhibited the formation of oligomeric and protofibrillar structures. The scFv binds the carboxyl terminal region of alpha-synuclein, suggesting that perturbation of this region can influence folding and aggregation of alpha-synuclein in vitro along with the previously identified hydrophobic core region of alpha-synuclein (residues 61-95, particularly residues 71-82). Since the scFv has been isolated from an antibody library based on human gene sequences, such scFv's can have potential therapeutic value in controlling aggregation of alpha-synuclein in vivo when expressed intracellularly as intrabodies in dopaminergic neurons.

Amino Acid Sequence↗
PubMed2005

Structural details of the thermophilic filamentous bacteriophage PH75 determined by polarized Raman microspectroscopy.

The filamentous virus PH75, which infects the thermophile Thermus thermophilus, consists of a closed DNA strand of 6500 nucleotides encapsidated by 2700 copies of a 46-residue coat subunit (pVIII). The PH75 virion is similar in composition to filamentous viruses infecting mesophilic bacteria but is distinguished by in vivo assembly at 70 degrees C and thermostability to at least 90 degrees C. Structural details of the PH75 assembly are not known, although a fiber X-ray diffraction based model suggests that capsid subunits are highly alpha-helical and organized with the same symmetry (class II) as in the mesophilic filamentous phages Pf1 and Pf3 [Pederson et al. (2001) J. Mol. Biol. 309, 401-421]. This is distinct from the symmetry (class I) of phages fd and M13. We have employed polarized Raman microspectroscopy to obtain further details of PH75 architecture. The spectra are interpreted in combination with known Raman tensors for modes of the pVIII main chain (amide I) and Trp and Tyr side chains to reveal the following structural features of PH75: (i) The average pVIII peptide group is oriented with greater displacement from the virion axis than peptide groups of fd, Pf1, or Pf3. The data correspond to an average helix tilt angle of 25 degrees in PH75 vs 16 degrees in fd, Pf1, and Pf3. (ii) The indolyl ring of Trp 37 in PH75 projects nearly equatorially from the subunit alpha-helix axis, in contrast to the more axial orientations for Trp 26 of fd and Trp 38 of Pf3. (iii) The phenolic rings of Tyr 15 and Tyr 39 project along the subunit helix axis, and one phenoxyl engages in hydrogen-bonding interaction that has no counterpart in either fd or Pf1 tyrosines. Also, in contrast to fd, Pf1, and Pf3, the packaged DNA genome of PH75 exhibits no Raman anisotropy, suggesting that DNA bases are not oriented unidirectionally within the nucleocapsid assembly. The structural findings are discussed in relation to intrasubunit and intersubunit interactions that may confer hyperthermostability to the PH75 virion. A refined molecular model is proposed for the PH75 capsid subunit.

Amides↗
PubMed2004

Effects of virion and salt concentrations on the Raman signatures of filamentous phages fd, Pf1, Pf3, and PH75.

Filamentous phages consist of a single-stranded DNA genome encapsidated by several thousand copies of a small alpha-helical coat protein subunit plus several copies of four minor proteins at the filament ends. The filamentous phages are important as cloning vectors, vehicles for peptide display, and substrates for macromolecular alignment. Effective use of a filamentous phage in such applications requires an understanding of experimental factors that may influence the propensity of viral filaments to laterally aggregate in solution. Because the Raman spectrum of a filamentous phage is strongly dependent on the relative orientation of the virion with respect to the polarization direction of the electromagnetic radiation employed to excite the spectrum, we have applied Raman spectroscopy to investigate lateral aggregation of phages fd, Pf1, Pf3, and PH75 in solution. The results show that lateral aggregation of the virions and anisotropic orientation of the aggregates are both disfavored by high concentrations of salt (>200 mM NaCl) in solutions containing a relatively low virion concentration (<10 mg/mL). Conversely, the formation of lateral aggregates and their anisotropic orientation are strongly favored by a low salt concentration (<0.1 mM NaCl), irrespective of the virion concentration over a wide range. The use of Raman polarization effects to distinguish isotropic and anisotropic solutions of filamentous phages is consistent with previously reported Raman analyses of virion structures in both solutions and fibers. The Raman data are supported by electron micrographs of negatively stained specimens of phage fd, which permit an independent assessment of salt effects on lateral aggregation. The present results also identify new Raman bands that serve as potential markers of subunit side-chain orientations in filamentous virus assemblies.

Anisotropy↗
PubMed1996

Structure and dynamics of bacteriophage IKe major coat protein in MPG micelles by solution NMR.

The structure and dynamics of the 53-residue filamentous bacteriophage IKe major coat protein in fully protonated myristoyllysophosphatidylglycerol (MPG) micelles were characterized using multinuclear solution NMR spectroscopy. Detergent-solubilized coat protein [sequence: see text] mimics the membrane-bound "assembly intermediate" form of the coat protein which occurs during part of the phage life cycle. NMR studies of the IKe coat protein show that the coat protein is largely alpha-helical, exhibiting a long amphipathic surface. helix (Asn 4 to Ser 26) and a shorter "micelle-spanning" C-terminal helix which begins at TRP 29 and continues at least to Phe 48. Pro 30 likely occurs in the first turn of the C-terminal helix, where it is ideally situated given the hydrogen bonding and steric restrictions imposed by this residue. The similarity of 15N relaxation values (T1, T2, and NOE and 500 MHz and T2 at 600 MHz) among much of the N-terminal helix and all of the TM helix indicates that the N-terminal helix is as closely associated with the micelle as the TM helix. The description of the protein in the micelle is supported by the observation of NOEs between lysolipid protons and protein amide protons between asn 8 and Ser 50. The N-terminal and TM helices exhibit substantial mobility on the microsecond to second time scale, which likely reflects changes in the orientation between the two helices. The overall findings serve to clarify the role of individual residues in the context of a TM alpha-helix and provide an understanding of the secondary structure, dynamics, and aqueous and micellar environments of the coat protein.

Amino Acid Sequence↗
PubMed1998

Amide modes of the alpha-helix: Raman spectroscopy of filamentous virus fd containing peptide 13C and 2H labels in coat protein subunits.

The filamentous virus fd consists of a single-stranded DNA genome sheathed by 2700 copies of a 50-residue alpha-helical subunit (protein pVIII) and serves as a model assembly of alpha-helices. To advance vibrational assignments for the alpha-helix, we have investigated Raman spectra of fd virions containing 13C and 2H (deuterium) labels at various main-chain sites of the pVIII subunits. 13C was introduced at specific peptide carbonyls, while deuterium was introduced at selected alpha-carbon (Calpha) and amide nitrogen positions. Interpretation of the Raman spectra reveals a previously unrecognized alpha-helix band in the spectral interval 730-745 cm-1, tentatively assigned to a carbonyl in-plane bending mode (amide IV). Experimental evidence has also been obtained for a distinctive alpha-helix marker near 1345 cm-1, assigned to a coupled Calpha-H bending and Calpha-C stretching mode. The fd virions containing 13C-labeled carbonyls exhibit unexpectedly complex amide I profiles, consisting of multiple band components. Amide I splitting resulting from 13C substitution of carbonyls is attributed to decoupling of transition-dipole interactions normally occurring in the extended pVIII helix. The present study identifies novel conformation-dependent Raman bands in a native alpha-helix assembly, confirms amide I and amide III assignments proposed previously for filamentous viruses, and facilitates new Raman assignments for the packaged ssDNA. The alpha-helix markers identified here should also be useful in conformation analyses of other proteins by Raman spectroscopy.

Amides↗
PubMed1998

Circular dichroism and electron microscopy of a core Y61F mutant of the F1 gene 5 single-stranded DNA-binding protein and theoretical analysis of CD spectra of four Tyr --> Phe substitutions.

A core Y61F mutant of the gene 5 single-stranded DNA-binding protein (g5p) of f1 bacterial virus aggregated when expressed from a plasmid, but, after refolding in vitro, it behaved much like wild-type and may be a stability or folding mutant. Circular dichroism (CD) titrations showed the same cooperative polynucleotide binding modes for Y61F and wild-type g5p. There are n = 4 and n congruent with 2.5 modes for binding to poly[d(A)] at low ionic strengths, but n = 4, n = 3, and n congruent with 2-2.5 modes for binding to fd single-stranded viral DNA (fd ssDNA), where n is the number of nucleotides occluded by each bound g5p monomer in a given mode. Y61F g5p has slightly reduced affinity in the n = 4 mode. Electron microscopy showed that Y61F g5p forms left-handed nucleoprotein superhelices indistinguishable from wild-type. Progression from binding to fd ssDNA in the n = 4 to n = 3 to n congruent with 2-2.5 mode is accompanied by an increase in the number of helical turns, an increase from (7.7 +/- 0.3) to (9.5 +/- 0.3) to ( approximately 10-13) g5p dimers per turn, and a decrease in the number of DNA nucleotides per turn. From CD spectra for four of five possible Y --> F g5p mutants, we infer that the fifth tyrosine, Tyr 56, contributes strongly to the CD. Retention of a strong 229 nm CD band in all mutants indicates that all retain elements of the native structure. Spectra of Y26F, Y34F, and Y61F g5p imply limited mobility of the replacement Phe. Comparison of measured with calculated CD spectra also suggests limited mobility for Tyr 26 and Tyr 34 in g5p in solution, and provides new information that the g5p structure in solution may be dominated by Tyr 41 rotamers differing from that stabilized in the crystal.

Amino Acid Substitution↗
PubMed1999

Demonstration by ultraviolet resonance Raman spectroscopy of differences in DNA organization and interactions in filamentous viruses Pf1 and fd.

Pf1, a class II filamentous virus, has been investigated by ultraviolet resonance Raman (UVRR) spectroscopy with excitation wavelengths of 257, 244, 238, and 229 nm. The 257-nm UVRR spectrum is rich in Raman bands of the packaged single-stranded DNA (ssDNA) genome, despite the low DNA mass (6%) of the virion. Conversely, the 229-nm UVRR spectrum is dominated by tyrosines (Tyr 25 and Tyr 40) of the 46-residue alpha-helical coat subunit. UVRR spectra excited at 244 and 238 nm exhibit Raman bands diagnostic of both viral DNA and coat protein tyrosines. Raman markers of packaged Pf1 DNA contrast sharply with those of the DNA packaged in the class I filamentous virus fd [Wen, Z. Q., Overman, S. A., and Thomas, G. J., Jr. (1997) Biochemistry 36, 7810-7820]. Interestingly, deoxynucleotides of Pf1 DNA exhibit sugars in the C2'-endo/anti conformation and bases that are largely unstacked, compared with C3'-endo/anti conformers and very strong base stacking in fd DNA; hydrogen-bonding interactions of thymine carbonyls are also different in Pf1 and fd. On the other hand, coat protein tyrosines of Pf1 exhibit Raman markers of ring environment identical to those of fd, including an anomalous singlet at 853 cm-1 in lieu of the canonical Fermi doublet (850/830 cm-1) found in globular proteins. The results indicate markedly different modes of organization of ssDNA in Pf1 and fd virions, despite similar environments for coat protein tyrosines, and suggest strong hydrogen-bonding interactions between DNA bases and coat subunits of Pf1 but not between those of fd. We propose that structural relationships between the protein coat and encapsidated ssDNA genome are also fundamentally different in the two assemblies.

Capsid↗
PubMed1999

Raman markers of nonaromatic side chains in an alpha-helix assembly: Ala, Asp, Glu, Gly, Ile, Leu, Lys, Ser, and Val residues of phage fd subunits.

The study of filamentous virus structure by Raman spectroscopy requires accurate band assignments. In previous work, site- and residue-specific isotope substitutions were implemented to elucidate definitive assignments for Raman bands arising from vibrational modes of the alpha-helical coat protein main chain and aromatic side chains in the class I filamentous phage, fd [Overman, S. A., and Thomas, G. J., Jr. (1995) Biochemistry 34, 5440-5451; Overman, S. A., and Thomas, G. J., Jr. (1998) Biochemistry 37, 5654-5665]. Here, we extend the previous methods and expand the assignment scheme to identify Raman markers of nonaromatic side chains of the coat protein in the native fd assembly. This has been accomplished by Raman analysis of 11 different fd isotopomers selectively incorporating deuterium at specific sites in either alanine, aspartic acid, glutamic acid, glycine, isoleucine, leucine, lysine, serine, or valine residues of the coat protein. Raman markers are also identified for the corresponding deuterated side chains. In combination with previous assignments, the results provide a comprehensive understanding of coat protein contributions to the Raman signature of the fd virion and validate Raman markers assigned to the packaged single-stranded DNA genome. The findings described here show that nonaromatic side chains contribute prolifically to the fd Raman signature, that marker bands for specific nonaromatics differ in general from those observed in corresponding polypeptides and amino acids, and that the frequencies and intensities of many nonaromatic markers are sensitive to secondary and higher-order structures. Nonaromatic markers within the 1200-1400 cm-1 interval also interfere seriously with the diagnostic Raman amide III band that is normally exploited in secondary structure analysis. Implications of these findings for the assessment of protein conformation by Raman spectroscopy are considered.

Alanine↗
PubMed2000

Intensity of the polarized Raman band at 1340-1345 cm-1 as an indicator of protein alpha-helix orientation: application to Pf1 filamentous virus.

Raman spectra of oriented alpha-helical protein molecules exhibit a prominent band near 1340-1345 cm(-)(1), the intensity of which is highly sensitive to molecular orientation. Polarization of the 1340-1345 cm(-)(1) marker is evident in Raman spectra of alpha-helical poly-L-alanine (alphaPLA) and alpha-helical poly-gamma-benzyl-L-glutamate (alphaPBLG). Corresponding polarization is also observed in Raman spectra of the filamentous virus Pf1, which is an assembly of alpha-helical coat protein molecules. In alphaPLA and alphaPBLG, we assign the band to a normal mode of symmetry type E(2) and specifically to a vibration localized in the (O=C)-C(alpha)-H linkages of the main chain peptide group. Although strict helical symmetry does not apply to coat subunits of filamentous viruses, an approximate E(2)-type mode may be presumed to account for a corresponding Raman band of Pf1 and fd filamentous viruses. Spectroscopic studies of N-methylacetamide and isotopically-edited fd viruses support the present assignment of the 1340-1345 cm(-)(1) band. Polarization anisotropy indicates that this band may be exploited as a novel indicator of protein alpha-helix orientation. Application of this approach to the polarized Raman spectrum of Pf1 suggests that, on average, the axis of the alpha-helical coat protein subunit in the native virion structure forms an angle of 20 +/- 10 degrees with respect to the virion axis.

Alanine↗
PubMed2000

Membrane assembly of the bacteriophage Pf3 major coat protein.

The Pf3 major coat protein of the Pf3 bacteriophage is stored in the inner membrane of the infected cell during the reproductive cycle. The protein consists of 44 amino acids, and contains an acidic amphipathic N-terminal domain, a hydrophobic domain, and a short basic C-terminal domain. The mainly alpha-helical membrane-bound protein traverses the membrane once, leaving the C-terminus in the cytoplasm and the N-terminus in the periplasm. A cysteine-scanning approach was followed to measure which part of the membrane-bound Pf3 protein is inside or outside the membrane. In this approach, the fluorescence probe N-[(iodoacetyl)amino]ethyl-1-sulfonaphthylamine (IAEDANS) was attached to single-cysteine mutants of the Pf3 coat protein. The labeled mutant coat proteins were reconstituted into the phospholipid DOPC/DOPG (80/20 molar ratio) and DOPE/DOPG (80/20 molar ratio) model membranes. We subsequently studied the fluorescence characteristics at the different positions in the protein. We measured the local polarity of the environment of the probe, as well as the accessibility of the probe to the fluorescence quencher acrylamide. The results of this study show a single membrane-spanning protein with both the C- and N-termini remaining close to the surface of the membrane. A nearly identical result was seen previously for the membrane-bound M13 coat protein. On the basis of a comparison between the results from both studies, we suggest an "L-shaped" membrane-bound model for the Pf3 coat protein. DOPE-containing model membranes revealed a higher polarity, and quenching efficiency at the membrane/water interface. Furthermore, from the outside to the inside of the membrane, a steeper polarity gradient was measured at the PE/PG interface as compared to the PC/PG interface. These results suggest a thinner interface for DOPE/DOPG than for DOPC/DOPG membranes.

Amino Acid Sequence↗
PubMed2004

A study of alpha-helix hydration in polypeptides, proteins, and viruses using vibrational raman optical activity.

A vibrational Raman optical activity (ROA) study, supplemented by protein X-ray crystal structure data, of alpha-helices in polypeptides, proteins, and viruses has suggested that ROA bands in the extended amide III spectral region may be used to distinguish between two types of right-handed alpha-helix. One type, associated with a positive ROA band at approximately 1300 cm(-1), dominates in hydrophobic environments and appears to be unhydrated; the other, associated with a positive ROA band at approximately 1340 cm(-1), dominates in hydrophilic environments and appears to be hydrated. Evidence is presented to support the hypothesis that unhydrated alpha-helix corresponds to the canonical conformation alpha(c) and hydrated alpha-helix to a more open conformation alpha(o) stabilized by hydrogen bonding of a water molecule or a hydrophilic side chain to the peptide carbonyl. Alpha-helical poly(L-lysine) and poly(L-ornithine) in aqueous solution and poly(L-alanine) in dichloracetic acid display both bands, but alpha-helical poly(l-glutamic acid) in aqueous solution and poly(gamma-benzyl L-glutamate) in CHCl(3) display only the approximately 1340 cm(-1) band and so may exist purely as alpha(o) due to enhanced stabilization of this conformation by particular side chain characteristics. The ROA spectrum of poly(beta-benzyl L-aspartate) in CHCl(3) reveals that it exists in a single left-handed alpha-helical state more analogous to alpha(o) than to alpha(c).

Inovirus↗
PubMed2006

Supramolecular binding of cationic porphyrins on a filamentous bacteriophage template: toward a noncovalent antenna system.

Engineered viruses act as scaffolds to bind porphyrins on their surfaces, exploiting mainly electrostatic interactions. The close proximity between porphyrins and tryptophan residues, exposed on the solvent-accessible surface, leads to an efficient resonant energy transfer, which makes these systems suitable for developing noncovalent antenna systems.

Amino Acid Sequence↗
PubMed1999

Solid-state NMR triple-resonance backbone assignments in a protein.

Triple-resonance solid-state NMR spectroscopy is demonstrated to sequentially assign the 13C' and 15N amide backbone resonances of adjacent residues in an oriented protein sample. The observed 13C' chemical shift frequency provides an orientational constraint complementary to those measured from the 1H and 15N amide resonances in double-resonance experiments.

Capsid↗