PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Interspersed Repetitive Sequences”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 163 records · Page 9Linked to original sources
PubMed2003

Interspersed repeats are found predominantly in the "old" alpha satellite families.

The biased distribution of dispersed repeat insertions in various types of primate specific alpha satellites (AS) is being discussed in the literature in relation to the modes of AS evolution and their possible roles in maintenance and disruption of functional centromeres. However, such a bias has not been properly documented on a genome-wide scale so far. In this work, using a representative sample of about 100 insertions we show that the "old" AS contains at least 10 times more dispersed repeats than the "new" one. In the new arrays insertions accumulate mostly in poorly homogenized areas, presumably in the edges, and in the old AS, throughout the whole array length. Dating of L1 insertions in the old AS revealed that their massive accumulation started at or after the time when the new AS emerged and expanded in the genome and the centromere function had shifted to the new AS arrays.

Animals↗
PubMed2004

Mapping and initial analysis of human subtelomeric sequence assemblies.

Physical mapping data were combined with public draft and finished sequences to derive subtelomeric sequence assemblies for each of the 41 genetically distinct human telomere regions. Sequence gaps that remain on the reference telomeres are generally small,well-defined,and for the most part,restricted to regions directly adjacent to the terminal (TTAGGG)n tract. Of the 20.66 Mb of subtelomeric DNA analyzed, 3.01 Mb are subtelomeric repeat sequences (Srpt),and an additional 2.11 Mb are segmental duplications. The subtelomeric sequence assemblies are enriched >25-fold in short,internal (TTAGGG)n-like sequences relative to the rest of the genome; a total of 114 (TTAGGG)n-like islands were found,55 within Srpt regions,35 within one-copy regions,11 at one-copy/Srpt or Srpt/segmental duplication boundaries,and 13 at the telomeric ends of assemblies. Transcripts were annotated in each assembly,noting their mapping coordinates relative to their respective telomere and whether they originate in duplicated DNA or single-copy DNA. A total of 697 transcripts were found in 15.53 Mb of one-copy DNA,76 transcripts in 2.11 Mb of segmentally duplicated DNA,and 168 transcripts in 3.01 Mb of Srpt sequence. This overall transcript density is similar (within approximately 10%) to that found genome-wide. Zinc finger-containing genes and olfactory receptor genes are duplicated within and between multiple telomere regions.

Base Composition↗
PubMed1985

Sequence organization and developmental expression of an interspersed, repetitive element and associated single-copy DNA sequences in Dictyostelium discoideum.

We have examined the genomic organization and developmental expression pattern of a short, transcribed, interspersed repeat element and its associated single-copy sequences. We have previously shown that 1% of the polyadenylated [poly(A)+] RNA from vegetative cells contains sequences that hybridize to this repeat. The complementary RNA is heterogeneous in size, and 90% of its mass hybridizes to single-copy DNA. In this study, we examined a series of genomic DNAs and cDNAs derived from poly(A)+ RNAs which are complementary to the repeat. Comparisons of sequence data from various genomic and cDNA clones indicated that (AAC)n X (GTT)n is the common sequence element. The tandem repeat occurred in approximately 100 short segments (approximately 35 to 150 base pairs) per haploid genome interspersed with single-copy DNA. Probes from regions adjacent to this element hybridized to unique restriction fragments on DNA blots and unique poly(A)+ RNA species on RNA blots. The (AAC)n X (GTT)n sequence was asymmetrically transcribed with only (AAC)n sequences represented in RNA. The repeat was localized within the transcribed regions of several genes and 70 base pairs 5' to the transcription initiation site of another gene. Individual (AAC)n-containing RNAs exhibited a developmental pattern of expression suggestive of the coordinate expression of many AAC gene family members.

Base Sequence↗
PubMed1980

Sequence organisation in nuclear DNA from Physarum polycephalum. Interspersion of repetitive and single-copy sequences.

Nuclear DNA from Physarum polycephalum is shown to contain three sequence components by reassociation kinetic analysis; a foldback component consisting of 6% of the DNA, a component with the properties of repetitive sequences comprising 31% of the DNA, and a majority component containing 63% of the DNA which reassociates with the kinetics characteristic of single-copy sequences. The complement of repetitive sequences is comprised of about 80 families of repeated elements, each containing approximately 1800 repeats per family. On average, these sequences are 6.4% richer in guanine and cytosine than total Physarum nuclear DNA. The repetitive sequences within a single family appear not to be identical, since on denaturation and annealing they give rise to collections of heteroduplexes less stable than native DNA. It is calculated that these duplexes are about 10% mismatched on average. Hydroxyapatite binding of DNA fragments of different sizes containing reassociated repeated elements demonstrates that these sequences are interspersed with single-copy sequences in a large portion of the Physarum genome. These observations are confirmed by direct examination of reassociated DNA using the electron microscope. In this manner it is shown that repetitive sequence elements possess a wide spectrum of lengths averaging 590 nucleotide residues, and they are separated by intervening segments of DNA about 930 residues in length.

Base Sequence↗
PubMed1975

DNA sequence organization in the genomes of five marine invertebrates.

The arrangement of repetitive and non-repetitive sequence was studied in the genomic DNA of the oyster (Crassostrea virginica), the surf clam (Spisula solidissima), the horseshoe crab (Limulus polyphemus), a nemertean worm (Cerebratulus lacteus) and a jelly-fish (Aurelia aurita). Except for the jellyfish these animals belong to the protostomial branch of animal evolution, for which little information regarding DNA sequence organization has previously been available. The reassociation kinetics of short (250-300 nucleotide) and long (2,000-3,000 nucleotide) DNA fragments was studied by the hydroxyapatite method. It was shown that in each case a major fraction of the DNA consists of single copy sequences less than about 3,000 nucleotides in length, interspersed with short repetitive sequences. The lengths of the repetitive sequences were estimated by optical hyperchromicity and S1 nuclease measurements made on renaturation products. All the genomes studied include a prominent fraction of interspersed repetitive sequences about 300 nucleotides in length, as well as longer repetitive sequence regions.

Animals↗
PubMed1991

Sequence conservation in avian CR1: an interspersed repetitive DNA family evolving under functional constraints.

CR1 is a short interspersed repetitive DNA element originally identified in the domestic chicken (Gallus gallus). However, unlike virtually all other such sequences described to date, CR1 is not confined to one or a few closely related species. It is probably a ubiquitous component of the avian genome, having been detected in representatives of nine orders encompassing a wide spectrum of the class Aves. This identification was made possible by using the polymerase chain reaction (PCR), which revealed interspecific similarities not detected by conventional Southern analysis. DNA sequence comparisons between a CR1 element isolated from a sarus crane (Grus antigone) and those isolated from an emu (Dromaius novaehollandiae) showed that two short highly conserved regions are present. These are included within two regions previously characterized in the CR1 units of domestic fowl. One of these behaves as a transcriptional silencer and the other is a binding site for a nuclear protein. Our observations suggest that CR1 has evolved under functional constraints and that interspersed repetitive sequences as a class may constitute a more significant component of the eukaryotic genome than is generally acknowledged.

Animals↗
PubMed1981

A chicken middle-repetitive DNA sequence which shares homology with mammalian ubiquitous repeats.

We have identified and sequenced two members of a chicken middle repetitive DNA sequence family. By reassociation kinetics, members of this family (termed CRl) are estimated to be present in 1500-7000 copies per chicken haploid genome. The first family member sequenced (CRlUla) is located approximately 2 kb upstream from the previously cloned chicken Ul RNA gene. The second CRl sequence (CRl)Va) is located approximately 12 kb downstream from the 3' end of the chicken ovalbumin gene. The region of homology between these two sequences extends over a region of approximately 160 base pairs. In each case, the 160 base pair region is flanked by imperfect, but homologous, short direct repeats 10-15 base pairs in length. When the CRl sequences are compared with mammalian ubiquitous interspersed repetitive DNA sequences (human Alu and Mouse Bl families), several regions of extensive homology are evident. In addition, the short nucleotide sequence CAGCCTGG which is completely conserved in ubiquitous repetitive sequence families from several mammalian species is also conserved at a homologous position in the chicken sequences. These data imply that at least certain aspects of the sequence and structure of these interspersed repeats must predate the avian-mammalian divergence. It seems that the CRl family may possibly represent an avian counterpart of the mammalian ubiquitous repeats.

Animals↗
PubMed1999

Two SINE families associated with equine microsatellite loci.

BLAST searches of 61 equine microsatellite sequences revealed two related families of retroposons. The first family included seven markers, all of which showed significant homology to the Equine Repetitive Element-1 (ERE-1) Short Interspersed Nucleotide Element (SINE) sequence. Length of homology ranged from 76 to 171 bases with identities to the ERE-1 consensus sequence ranging from 71% to 83%. The second family referred to as Equine Repetitive Element-2 (ERE-2) has a consensus sequence that showed homology to ERE-1 over approximately 60 bases. These 60 bases comprised subunit I. Sequence comparisons for the two retroposons led to the identification of a subunit II, subunit III, as well as the tRNAser subunit. The subunit structure of ERE-1 was tRNAser-I-II. By contrast, the subunit structure of ERE-2 was I-III-III. The nine markers related to ERE-2 showed homology lengths ranging from 84 to 163 bases with identities ranging from 75% to 99%. In addition to being present in microsatellites, ERE-2 appeared in three separate equine genes. It occurred in an intron of DNA-PK, in an untranslated region as well as in the promoter of PGHS, and in the coding region of PAM. The amino acids corresponding to the ERE-2 sequence in PAM were not present in the human or mouse PAM homologs. These amino acids associated with the ERE-2 sequence were present on the cytosolic side of the transmembrane domain of the PAM enzyme. Microsatellite markers in the ERE-1 and ERE-2 families were found throughout the genus equus and also for rhinoceros, indicating that the appearance of both retroposons predates the divergence of equids from the other perissodactyls. The markers did not amplify in human or bovine DNA. This indicated that ERE-1 and ERE-2 are, at least, perissodactyl specific.

Amidine-Lyases↗
PubMedDate not supplied

Natural plasmid transformation in Escherichia coli.

Although Escherichia coli does not have a natural transformation process, strains of E. coli can incorporate extracellular plasmids into cytoplasm 'naturally' at low frequencies. A standard method was developed in which stationary phase cells were concentrated, mixed with plasmids, and then plated on agar plates with nutrients which allowed cells to grow. Transformed cells could then be selected by harvesting cells and plating again on selective agar plates. Competence developed in the lag phase, but disappeared during exponential growth. As more plasmids were added to the cell suspension, the number of transformants increased, eventually reaching a plateau. Supercoiled monomeric or linear concatemeric DNA could transform cells, while linear monomeric DNA could not. Plasmid transformation was not related to conjugation and was recA-independent. Most of the E. coli strains surveyed had this process. All tested plasmids, except pACYC184, could transform E. coli. Insertion of a DNA fragment containing the ampicillin resistance gene into pACYC184 made the plasmid transformable. By inserting random 20-base-pair oligonucleotides into pACYC184 and selecting for transformable plasmids, a most frequent sequence was identified. This sequence resembled the bacterial interspersed medium repetitive sequence of E. coli, suggesting the existence of a recognition sequence. We conclude that plasmid natural transformation exists in E. coli.

Base Sequence↗
PubMed1982

Small RNA molecules related to the Alu family of repetitive DNA sequences.

A rodent 4.5S RNA molecule with extensive homology to the Alu family of interspersed repetitive DNA sequences has been found physically associated with polyadenylated nuclear and cytoplasmic RNAs (W. Jelinek and L. Leinwand, Cell 15:205-214, 1978; S. Haynes et al., Mol. Cell. Biol. 1:573-583, 1981). In this report, we describe a 4.5S RNA molecule in rat cells whose RNase fingerprints are identical to those of the equivalent mouse molecule. We show that the rat 4.5S RNA is part of a small family of RNA molecules, all sharing sequence homology to the Alu family of DNA sequences. These RNAs are synthesized by RNA polymerase III and are developmentally regulated and short-lived in the cytoplasm. Of this family of small RNAs, only the 4.5S RNA is found associated with polyadenylated RNA.

Animals↗
PubMed1998

Identification of a new DNA region specific for members of Mycobacterium tuberculosis complex.

The successful use of DNA amplification for the detection of tuberculous mycobacteria crucially depends on the choice of the target sequence, which ideally should be present in all tuberculous mycobacteria and absent from all other bacteria. In the present study we developed a PCR procedure based on the intergenic region (IR) separating two genes encoding a recently identified mycobacterial two-component system named SenX3-RegX3. The senX3-regX3 IR is composed of a novel type of repetitive sequence, called mycobacterial interspersed repetitive units (MIRUs). In a survey of 116 Mycobacterium tuberculosis strains characterized by different IS6110 restriction fragment length polymorphisms, 2 Mycobacterium africanum strains, 3 Mycobacterium bovis strains (including 2 BCG strains), and 1 Mycobacterium microti strain, a specific PCR fragment was amplified in all cases. This collection included M. tuberculosis strains that lack IS6110 or mtp40, two target sequences that have previously been used for the detection of M. tuberculosis. No PCR fragment was amplified when DNA from other organisms was used, giving a sensitivity of 100% and a specificity of 100% in the confidence limit of this study. The numbers of MIRUs were found to vary among strains, resulting in six different groups of strains on the basis of the size of the amplified PCR fragment. However, the vast majority of the strains (approximately 90%) fell within the same group, containing two 77-bp MIRUs followed by one 53-bp MIRU.

DNA, Bacterial↗
PubMed2001

Mobile elements and the genesis of microsatellites in dipterans.

Factors that influence the genesis and genomic distribution of microsatellite DNA are poorly understood. We have identified a novel class of Dipteran mobile elements, mini-me elements, which help elucidate both of these issues. These retroposons contain two internal proto-microsatellite regions that commonly expand into lengthy microsatellite repeats. These elements are highly abundant, accounting for approximately 1.2% of the Drosophila melanogaster genome, giving them the potential to be a prolific source of microsatellite DNA variation. They also give us the opportunity to observe the outcomes of multiple microsatellite genesis events (initiating from the same proto-microsatellite) at separate mini-me loci. Based on these observations, we determined that the genesis of microsatellites within mini-me elements occurs through two separate mutational processes: the expansion of preexisting tandem repeats and the conversion of sequence with high cryptic simplicity into tandemly repetitive DNA. These modes of microsatellite genesis can be generalized beyond the case of mini-me elements and help to explain the genesis of microsatellites in any sequence region that is not constrained by selection.

Animals↗
PubMed1998

Specific differentiation between Mycobacterium bovis BCG and virulent strains of the Mycobacterium tuberculosis complex.

A PCR procedure based on the intergenic region (IR) separating two genes encoding a recently identified mycobacterial two-component system, named SenX3-RegX3, was developed and was shown to be suitable for identifying Mycobacterium bovis BCG. The senX3-regX3 IR contains a novel type of repetitive sequence, called mycobacterial interspersed repetitive units (MIRUs). All tested BCG strains exclusively contained 77-bp MIRUs within the senX3-regX3 IR, whereas all non-BCG M. tuberculosis complex strains contained a 53-bp MIRU, in addition to the 77-bp MIRUs. All 148 strains analyzed so far could be divided into eight different groups according to the copy numbers of the 77-bp MIRU and to the presence or absence of the 53-bp MIRU. BCG strains contained either one, two, or three 77-bp MIRUs. The other strains contained one to five 77-bp MIRUs invariably followed by a 53-bp MIRU. The consistent absence of the 53-bp MIRU in BCG strains and its presence in virulent strains allowed us to develop an enzyme-linked immunosorbent assay using specific capture oligonucleotide probes to distinguish between BCG and other M. tuberculosis complex strains.

Amino Acid Sequence↗
PubMed2006

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences.

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.

Amino Acid Sequence↗
PubMed2006

Mammalian small nucleolar RNAs are mobile genetic elements.

Small nucleolar RNAs (snoRNAs) of the H/ACA box and C/D box categories guide the pseudouridylation and the 2'-O-ribose methylation of ribosomal RNAs by forming short duplexes with their target. Similarly, small Cajal body-specific RNAs (scaRNAs) guide modifications of spliceosomal RNAs. The vast majority of vertebrate sno/scaRNAs are located in introns of genes transcribed by RNA polymerase II and processed by exonucleolytic trimming after splicing. A bioinformatic search for orthologues of human sno/scaRNAs in sequenced mammalian genomes reveals the presence of species- or lineage-specific sno/scaRNA retroposons (sno/scaRTs) characterized by an A-rich tail and an approximately 14-bp target site duplication that corresponds to their insertion site, as determined by interspecific genomic alignments. Three classes of snoRTs are defined based on the extent of intron and exon sequences from the snoRNA parental host gene they contain. SnoRTs frequently insert in gene introns in the sense orientation at genomic hot spots shared with other genetic mobile elements. Previously characterized human snoRNAs are encoded in retroposons whose parental copies can be identified by phylogenic analysis, showing that snoRTs can be faithfully processed. These results identify snoRNAs as a new family of mobile genetic elements. The insertion of new snoRNA copies might constitute a safeguard mechanism by which the biological activity of snoRNAs is maintained in spite of the risk of mutations in the parental copy. I furthermore propose that retroposition followed by genetic drift is a mechanism that increased snoRNA diversity during vertebrate evolution to eventually acquire new RNA-modification functions.

Animals↗
PubMed1985

The KpnI family of long interspersed nucleotide sequences is present on discrete sizes of circular DNA in monkey (BSC-1) cells.

Discretely sized molecules of small circular DNAs in African green monkey kidney (BSC-1) cells contain nucleotide sequences homologous to the KpnI family of long interspersed repetitive nucleotide sequences. The size distribution of these KpnI family-containing circular DNAs differs markedly from those of BSC-1 cell circular DNAs containing either the Alu family of short interspersed nucleotide sequences or the alpha-satellite family of tandemly repeated sequences. The structures of several cloned, apparently whole, KpnI family-related circular DNAs of varying sizes were analyzed and compared with a compilation of chromosomal KpnI sequences. In general, it was found that the cloned DNAs all contained only KpnI sequences, and that the recombination events given rise to them did not involve any noticeable gain of nucleotides.

Animals↗
PubMed1999

A LINE2 repetitive DNA sequence from the cichlid fish, Oreochromis niloticus: sequence analysis and chromosomal distribution.

We report the cloning and characterization of a long interspersed nucleotide element (LINE) from a cichlid fish, Oreochromis niloticus, and show the distribution of this element, called CiLINE2 for cichlid LINE2, in the chromosomes of this species. The identification of an open reading frame in CiLINE2 with amino acid sequence similarity to reverse transcriptases encoded by LINE-like elements in Caenorhabditis elegans, Platemys spixii, Schistosoma mansoni, Gallus gallus (CRI), Drosophila melanogaster (I factor), and Homo sapiens (LINE2), as well as the structure of the element, suggest it is a member of this family of non-long terminal repeat-containing retrotransposons. Search of a DNA sequence database identified sequences similar to CiLINE2 in four other fish species (Haplotaxodon microlepis, Oreochromis mossambicus, Pseudotropheus zebra, and Fugu rubripes). Southern blot hybridization experiments revealed the presence of sequences similar to CiLINE2 in all Tilapiini species analyzed from the genera Oreochromis, Tilapia, and Sarotherodon, and gave an estimated copy number of about 5500 for the haploid genome of O. niloticus. Fluorescent in situ hybridization showed that CiLINE2 sequences were organized in small clusters dispersed over all chromosomes of O. niloticus, with a higher concentration near chromosome ends. Furthermore, the long arm of chromosome 1 was strikingly enriched with this sequence. The distribution of LINE2-related elements might underlie the difference in chromosome banding patterns observed between cold-blooded vertebrates and mammals.

Amino Acid Sequence↗