PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “duplex sequencing”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 163 records · Page 9Linked to original sources

Inherent DNA curvature and flexibility correlate with TATA box functionality.

Four 1.5 ns molecular dynamics (MD) simulations were performed on the d(GCTATAAAAGGG).d(CCCTTTTATAGC) double helix dodecamer bearing the Adenovirus major late promoter TATA element and three iso-composition mutants for which physical and biochemical data are available from the same laboratory. Three of these DNA sequences experimentally induce tight binding with the TATA box binding protein (TBP) and induce high transcription rates; the other DNA sequence induces much lower TBP binding and transcription. The x-ray crystal structures have previously shown that the duplex DNA in DNA-TBP complexes are highly bent. We performed and analyzed MD simulations for these four DNAs, whose experimental structures are not available, in order to address the issue of whether inherent DNA structure and flexibility play a role in establishing these observed preferences. A comparison of the experimental and simulated results demonstrated that DNA duplex sequence-dependent curvature and flexibility play a significant role in TBP recognition, binding, and transcriptional activation.

Adenoviridae↗

A potential stem-loop structure and the sequence CAAUCAA in the transcript are insufficient to signal rho-dependent transcription termination at lambda tR1.

It has been suggested that a sequence in the RNA transcript that can form a stem and loop structure, followed by the sequence CAAUCAA, is the signal for rho-dependent transcription termination. We tested this hypothesis by synthesizing a DNA duplex whose sequence corresponds to a region of the lambda tR1 terminator that contains these structural features. We cloned this synthetic DNA fragment under the control of the lacUV5 promoter, and showed that it does not cause rho-dependent termination in vitro. RNA polymerase pauses during in vitro transcription across the synthetic sequence, although less efficiently than at the corresponding sequence on the lambda template. No rho-mediated termination was detected even under conditions that prolonged transcriptional pausing at the synthetic site, indicating that the synthetic sequence is defective as a transcript release site. We suggest that unlike rho-independent terminators, rho-dependent terminators require sequences in addition to those immediately before the sites of termination.

Base Sequence↗

Purification and properties of Drosophila heat shock activator protein.

Drosophila heat shock activator protein, a rare transacting factor which is induced upon heat shock to bind specifically to the heat shock regulatory sequence in vivo, has been purified from shocked cells to more than 95 percent homogeneity by sequence-specific duplex oligonucleotide affinity chromatography. The purified protein has a relative molecular mass of 110 kilodaltons, binds to the regulatory sequence with great affinity and specificity, and strongly stimulates transcription of the Drosophila hsp70 gene. Studies with this regulatory protein should lead to an understanding of the biochemical pathway underlying the heat shock phenomenon.

Animals↗

Sequence preferences of DNA interstrand crosslinking agents: quantitation of interstrand crosslink locations in DNA duplex fragments containing multiple crosslinkable sites.

A general approach to the quantitative study of the sequence specificity of DNA interstrand crosslinking agents in synthetic duplex DNA fragments is described. In the first step, a DNA fragment previously treated with an interstrand crosslinking agent is subjected to denaturing PAGE. Not only does this distinguish crosslinked from native or monoadducted DNA, it is shown herein that isomeric crosslinked DNAs differing in position of the crosslink can in some cases be separated. In the second stage, the now fractionated crosslinked DNAs isolated from denaturing PAGE are subjected to fragmentation using iron(II)/EDTA. For those fractions which are structurally homogeneous, analysis of the resulting fragment distribution has previously been shown to reveal the crosslink position at nucleotide resolution. It is shown herein that in fractions which are structurally heterogeneous due to differences in position of crosslink, this analysis quantifies the relative extent of crosslinking at distinct sites. Using this method it is shown that reductively activated mitomycin C crosslinks the duplex sequences 5'-GCGC and 5'-TCGA with 3 +/- 1:1 relative efficiency.

Base Sequence↗

Minor-groove binding models for acetylaminofluorene modified DNA.

Minimized potential energy calculations have been employed to locate and evaluate energetically a number of different models for DNA modified at carbon-8 of guanine by acetylaminofluorene (AAF). Three different duplex nonamer sequences were investigated. In addition to syn guanine models which have some denaturation and a Z-DNA model, we have found two new types of structures in which guanine remains syn and the AAF is placed in the minor groove of a B-DNA helix. One type features Hoogsteen base pairing between the modified guanine and protonated cytosine, with a sharply bent helix. The other (here termed the "wedge" model because the aromatic amine is wedged into the minor groove) maintains a single hydrogen bond between O6 of the modified guanine and N3 of protonated cytosine, with much less deformation of the helix, and close Van der Waals contacts between the AAF and the walls of the minor groove. Both types of structures (as well as the related forms produced by deprotonation of cytosine) are energetically important in all three sequences examined. The wedge-type model, which is most favored except in alternating G-C sequences, has been previously observed in a combined NMR and computational characterization of an aminofluorene (AF) modified guanine opposite adenine in a DNA duplex undecamer (D. Norman, P. Abuaf, B.E. Hingerty, D. Live, D. Grunberger, S. Broyde and D.J. Patel, Biochemistry 28, 7462 (1989)).

2-Acetylaminofluorene↗

Sequence-specific artificial photo-induced endonucleases based on triple helix-forming oligonucleotides.

Homopyrimidine oligonucleotides bind to homopurine-homopyrimidine sequences of duplex DNA forming a local triple helix. This binding can be demonstrated either directly by a footprinting technique, gel assays, or indirectly by inducing irreversible reactions in the target sequence, such as photocrosslinking or cleavage. Binding occurs in the major groove with the homopyrimidine oligonucleotide orientated parallel to the homopurine strand. Thymine and protonated cytosine in the oligonucleotide form Hoogsteen-type hydrogen bonds with A.T and G.C Watson-Crick base pairs, respectively. Here we report that an 11-residue homopyrimidine oligonucleotide covalently attached to an ellipticine derivative by its 3' phosphate photo-induces cleavage of the two strands of a target homopurine--homopyrimidine sequence. To our knowledge, this is the first reported case of a sequence-specific artificial photoendonuclease. In addition we show that a strong binding site for a free ellipticine derivative is induced at the junction between the triplex and duplex structures on the 5' side of the bound oligonucleotide. On irradiation, cleavage is observed on both strands of DNA. This opens new possibilities for inducing irreversible reactions on DNA at specific sites by the synergistic action of a triple helix-forming oligonucleotide and an intercalating agent.

Alkaloids↗

Hairpin structures in synthetic oligodeoxynucleotides: sequence effects on the duplex-to-hairpin transition.

We have synthesized and examined a number of fully and partly self-complementary palindromic oligodeoxynucleotides for their ability to assume in solution a unimolecular hairpin structure. The main results obtained by a combined optical and electrophoresis investigation show that: (i) DNA folding needs not be driven by mismatched base pairings over the dyad; fully self-complementary palindromic duplexes, comprising regular (CG)n DNA fragments, possess a considerable intrinsic propensity to make intramolecular base pairings; (ii) The duplex-hairpin interconversion is, in general, a slow process independent of the length and base composition of the palindrome; (iii) The palindromic sequences energetically least favored to form hairpin structures consist of C:G base pairs around the dyad axis and of T:A blocks in the arms of the inverted repeat; (IV) The base composition of the stem strongly influences the hairpin thermal stability. For instance, the substitution of one C:G with one A:T base pair in the stem helix of d(CG)7 diminishes the stability of the hairpin by 9 degrees C. It is found that the stability of the stem helix, in hairpins of defined sequence and with the same loop length, decreases in the order alternating-CG greater than homo-CG greater than AC(GT) greater than alternating-AT, i.e. as in polynucleotides. The thermodynamic parameters for the hairpin-coil transition are reported.

Base Composition↗

Identification and purification of the enhancer-binding factor of human immunodeficiency virus-1. Multiple proteins and binding to other enhancers.

The enhancer-binding factor of human immunodeficiency virus (HIV)-1 was purified from human B cells by sequence-specific duplex oligonucleotide affinity chromatography. Gel retardation assay and footprint analysis showed that the purified factor bound specifically to the HIV-1 enhancer sequence, and protected both direct repeats in the HIV-1 enhancer. The purified factor consisted of four main polypeptides of the molecular weight of 36,000-42,000. At least three of them had enhancer-binding activity after elution from sodium dodecyl sulfate-polyacrylamide gel and renaturation. UV cross-linking analysis also showed that at least two of the polypeptides in purified fraction had a binding activity specific for the HIV-1 enhancer. The purified factor activated transcription from the HIV-1 promoter in vitro, confirming that it was indeed a transcription factor for HIV-1. The purified factor also recognized sequences in the immunoglobulin kappa gene enhancer and the major histocompatibility complex class I gene enhancer with almost the same affinity as the HIV-1 enhancer. These results suggested the existence of multiple proteins which recognize the kappa B-related sequences. This regulatory factor should help in the study of the biochemical pathway underlying HIV production from latently infected cells.

Base Sequence↗

Sequence specificity of triplex DNA formation: Analysis by a combinatorial approach, restriction endonuclease protection selection and amplification.

We have devised a combinatorial method, restriction endonuclease protection selection and amplification (REPSA), to identify consensus ligand binding sequences in DNA. In this technique, cleavage by a type IIS restriction endonuclease (an enzyme that cleaves DNA at a site distal from its recognition sequence) is prevented by a bound ligand while unbound DNA is cleaved. Since the selection step of REPSA is performed in solution under mild conditions, this approach is amenable to the investigation of ligand-DNA complexes that are either insufficiently stable or not readily separable by other methods. Here we report the use of REPSA to identify the consensus duplex DNA sequence recognized by a G/T-rich oligodeoxyribonucleotide under conditions favoring purine-motif triple-helix formation. Analysis of 47 sequences indicated that recognition between 13 bases on the oligonucleotide 3' end and the duplex DNA was sufficient for triplex formation and indicated the possible existence of a new base triplet, G.AT. This information should help identify appropriate target sequences for purine-motif triplex formation and demonstrates the power of REPSA for investigating ligand-DNA interactions.

Base Sequence↗

Homologous recognition promoted by RecA protein via non-Watson-Crick bonds between identical DNA strands.

The RecA protein of Escherichia coli forms a nucleoprotein filament that promotes homologous recognition and subsequent strand exchange between a single strand and duplex DNA via a three-stranded intermediate. Recognition of homology within three-stranded nucleoprotein complexes, which is probably central to genetic recombination, is not well understood as compared with the mutual recognition of complementary single strands by Watson-Crick base pairing. Using oligonucleotides, we examined the determinants of homologous recognition within RecA nucleoprotein filaments. Filaments that contained a single strand of DNA recognized homology not only in a complementary oligonucleotide but also in an identical oligonucleotide, whether their respective sugar-phosphate backbones were antiparallel or parallel, and a filament that contained duplex DNA showed the same polymorphic versatility in the recognition of homology. Recognition of self by a filament that contains a single strand reveals that RecA filaments can recognize homology via non-Watson-Crick hydrogen bonds. Recognition of multiple forms of the same sequence by duplex DNA in the filament shows that it primarily senses base-sequence homology, and suggests that recognition can be accomplished prior to the establishment of new Watson-Crick base pairs in heteroduplex products. However, unlike the initial recognition of homology, strand exchange is stereospecific, requiring the proper antiparallel orientation of complementary strands.

Bacteriophage M13↗

GG versus AG Platination: A Kinetic Study on Hairpin-Stabilized Duplex Oligonucleotides.

The kinetics of the reactions between the diaqua form of the antitumor drug cisplatin, cis-[Pt(NH(3))(2)(H(2)O)(2)](2+), and two hairpin-stabilized duplex oligonucleotides, d(TATGGTATTTTTATACCATA) (I) and d(TATAGTATTTTTATACTATA) (II), were investigated. Oligonucleotides I and II were used as models for GG and AG sequences within duplex DNA, which are known as the major sites of platinum binding. The two GG guanines of I are shown to react with similar rates (k(5)(') = 18 +/- 2 and k(3)(') = 15 +/- 1 M(-)(1) s(-)(1)), roughly twice as fast as the AG guanine of II (k(3)(') = 9 +/- 1 M(-)(1) s(-)(1)). Platination of the AG adenine of II was also observed to a minor extent (k(5)(') = 1.5 +/- 0.3 M(-)(1) s(-)(1)), whereas no other adenine of I or II was platinated to a detectable extent. The overall platination rate of I is approximately three times larger than that of II. The 3'-monoadduct of I undergoes chelation to the GG intrastrand adduct with a rate 10.5 times larger than the 5'-monoadduct (k(3)(')(c) = (1.9 +/- 0.1) x 10(-)(3) s(-)(1) and k(5)(')(c) = (0.18 +/- 0.05) x 10(-)(3) s(-)(1)). For II, the chelation rate constants of the guanine- and adenine-bound monoadducts are k(5)(')(c) = 0.3 +/- 0.1 and k(3)(')(c) = 0.08 +/- 0.01 s(-)(1), respectively. These results are discussed in relation to the platination kinetics determined for other model systems.

Journal Article↗

Targeted gene knockout mediated by triple helix forming oligonucleotides.

Triple helix forming oligonucleotides (TFOs) recognize and bind sequences in duplex DNA and have received considerable attention because of their potential for targeting specific genomic sites. TFOs can deliver DNA reactive reagents to specific sequences in purified chromosomal DNA (ref. 4) and nuclei. However, chromosome targeting in viable cells has not been demonstrated, and in vitro experiments indicate that chromatin structure is incompatible with triplex formation. We have prepared modified TFOs, linked to the DNA-crosslinking reagent psoralen, directed at a site in the Hprt gene. We show that stable Hprt-deficient clones can be recovered following introduction of the TFOs into viable cells and photoactivation of the psoralen. Analysis of 282 clones indicated that 85% contained mutations in the triplex target region. We observed mainly deletions and some insertions. These data indicate that appropriately constructed TFOs can find chromosomal targets, and suggest that the chromatin structure in the target region is more dynamic than predicted by the in vitro experiments.

Animals↗

Abasic sites in duplex DNA: molecular modeling of sequence-dependent effects on conformation.

Molecular modeling calculations using JUnction Minimization of Nucleic Acids (JUMNA) have been used to study sequence effects on the conformation of abasic sites within duplex DNA. We have considered lesions leading to all possible unpaired bases (X), adenine, guanine, cytosine, or thymine contained within two distinct sequence contexts, CXC and GXG. Calculations were carried out on DNA 11-mers using extensive conformational search techniques to locate the most stable abasic conformations and using Poisson-Boltzmann corrected electrostatics to account for solvation effects. The results, which are in very good agreement with available experimental data, point to strong sequence effects on both the position of the unpaired base (intra or extrahelical) and on the overall curvature induced by the abasic lesion. For CXC, unpaired purines are found to lie within the helix, while unpaired pyrimidines are either extrahelical or in equilibrium between the intra and extrahelical forms. For GXG, all unpaired bases lead to intrahelical forms, but with marked, sequence-dependent differences in induced curvature.

Base Pairing↗

Chiral recognition of deoxyoligonucleotides by delta- and lambda-tris(ethylenediamine)cobalt(III).

59Co NMR and CD measurements show for both stereoisomers of Co(en)3(3+) a similar trend in the sequence dependence of DNA recognition, as was reported previously for Co(NH3)6(3+). In particular, specific binding is evident to DNA molecules possessing runs of two or more same-strand guanine residues. The binding of either isomer to such sequences induces structural transitions toward A-DNA characteristics. Such measurements also show significant differences between the two stereoisomers in terms of how they recognize specific duplex DNA sequences. delta-Co(en)3(3+) binds more tightly than lambda-Co(en)3(3+) to right-handed, guanine-rich DNA, whereas lambda-Co(en)3(3+) binds more tightly than delta-Co(en)3(3+) to left-handed DNA. The two stereoisomers bind in an indistinguishable manner to AT-rich DNA.

Base Sequence↗

Triplex targeting of human PDGF-B (c-sis, proto-oncogene) promoter specifically inhibits factors binding and PDGF-B transcription.

Human c-sis/PDGF-B proto-oncogene has been shown to be overexpressed in a large percentage of human tumor cells establishing a growth-promoting, autocrine growth circuit. Triplex forming oligonucleotides (TFOs) can recognize and bind sequences in duplex DNA, and have received considerable attention because of their potential for targeting specific genomic sites. The c-sis/PDGF-B promoter contains a unique homopurine/homopyrimidine sequence (SIS proximal element, SPE), which is crucial for binding nuclear factors that provoke transcription. In order to develop specific transcriptional inhibitors of the human c-sis/PDGF-B proto-oncogene, 20 potential TFOs targeting part or all of the SPE were screened by gel mobility analysis. DNase I footprinting shows that the TFOs we designed can form a sequence-specific triplex with the target. Protein binding assays demonstrate that triplex formation inhibits nuclear factors binding the c-sis/PDGF-B promoter. Both transient and stable transfection experiments demonstrate that the transcriptional activity of the promoter is considerably inhibited by the TFOs. We propose that TFOs represent a therapeutic potential to specifically diminish the expression of c-sis/PDGF-B proto-oncogene in various pathologic settings where constitutive expression of this gene has been observed.

Base Sequence↗

Padlock oligonucleotides for duplex DNA based on sequence-specific triple helix formation.

An oligonucleotide was circularized around double-stranded DNA thanks to triple helix formation. Short oligonucleotides are known to be able to form DNA triple helices by binding into the DNA major groove at an oligopurine.oligopyrimidine sequence. After sequence-specific recognition of a double-stranded DNA target through triple helix formation, the ends of the triplex-forming oligonucleotide were joined through the action of T4 DNA ligase, thus creating a circular DNA molecule catenated to the plasmid containing the target sequence. The labeling of the double-stranded DNA sequence has been carried out without any chemical or enzymatic modification of this sequence. These "padlock" oligonucleotides provide a tool to attach a noncovalent tag in an irreversible way to supercoiled plasmid or other double-stranded DNAs. Such a complex may find applications in the development of new techniques for duplex DNA detection or plasmid delivery methods for gene therapy.

Animals↗