SEARCH · PubMed Health

Results for “bacterial coding sequence”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,657 records · Page 92Linked to original sources

PubMedDate not supplied

Control of the lux regulon of Vibrio fischeri.

Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗

PubMed1995

New open reading frames, one of which is similar to the nifV gene of Azotobacter vinelandii, found on a 12.5 kbp fragment of chromosome IV of Saccharomyces cerevisiae.

The nucleotide sequence of a 12.5 kbp segment of the left arm of chromosome IV is described. Five open reading frames (ORFs) longer than 100 amino acids were detected, all of which are completely confined to the 12.5 kbp region. Two ORFs (D1271 and D1286) correspond to previously sequenced genes (PPH22 and VMA1 or TFP1, respectively). ORF D1298 shows the characteristics of alpha-isopropylmalate and homocitrate synthase genes and is similar to the nifV gene of Azotobacter vinelandii. Two more ORFs have no apparent homologue in the data libraries. Conversely, two smaller ORFs of 25 and 85 amino acids encoding the ribosomal protein YL41A and an ATPase inhibitor, respectively, were detected. Although a substantial part of the 12.5 kbp fragment apparently lacks protein-coding characteristics, no other elements, such as tRNA genes or transposons, were found.

Amino Acid Sequence↗

PubMed1999

Phage abortive infection of Bacillus licheniformis ATCC 9800; identification of the abiBL11 gene and localisation and sequencing of its promoter region.

The virulent bacteriophage BL11 infects almost all Bacillus licheniformis strains tested, including the industrial bacitracin-producing B. licheniformis 19. B. licheniformis ATCC 9800, however, was virtually insensitive to phage BL11 infection, and all of the few surviving progeny phages proved to be mutants. The phage-resistance mechanism was neither inhibition of adsorption, nor restriction or exclusion provided by a resident prophage, but was, instead, of another type. Phage BL11 adsorbed well on to ATCC 9800 cells, its DNA was injected, but replication of phage DNA was inhibited and the infected cells died. Thus, the mechanism of phage resistance was identified as abortive infection (AbiBL11). The so-called abiBL11 gene was identified on the chromosome of strain ATCC 9800 by Tn917PF1 transposon mutagenesis. Part of the abiBL11 gene from the phage-sensitive ATCC 9800::Tn917PFI was cloned. Gene-disruption analysis, based on Campbell-type integration, showed that a 0.3-kb EcoRI fragment contained the 5' end of abiBL11. The promoter region of abiBL11 was identified using promoter- and terminator-probe plasmids. The deduced sequence (206 amino acids) of the N-terminal part of abiBL11 showed no significant homology to known abortive-infection genes, but did show homology to a Saccharomyces cerevisiae gene coding for a serine/threonine protein kinase (RCK1).

Amino Acid Sequence↗

PubMed1987

Novel blunt-end addition reactions catalyzed by DNA polymerase I of Escherichia coli.

DNA polymerase I (Klenow fragment) of Escherichia coli catalyzes the addition of deoxynucleotides to 3' hydroxyl termini of blunt-ended DNA fragments. The product of the reaction, which we call +1 addition, is found only in very low yield under conditions that permit editing by the 3'----5' exonuclease activity of the wild-type polymerase. A mutant form of the Klenow fragment that lacks detectable 3'----5' exonuclease activity shows an elevated accumulation of the +1 addition product. The mutant enzyme can use any one of the four dNTPs to carry out the reaction when each precursor is provided individually. However, in the presence of all four dNTPs the addition of dATP is strongly preferred. Suppression of the editing function of the wild-type polymerase through the use of high concentrations of exogenous deoxynucleoside monophosphates also results in a significant increase in the amount of +1 addition product formed. The presence of a high dNMP concentration also alters the specificity of the nucleotide addition reaction carried out by the wild-type enzyme. Thus, in addition to dATP, the dNTP which is complementary to the exogenous deoxynucleoside monophosphate, is also used in the +1 addition reaction. A similar effect of dNMPs on the specificity of nucleotide addition was obtained with the mutant Klenow fragment. These results define two pathways for the +1 addition reaction: one that does not require coding information from the DNA template and a second in which coding information is provided by the exogenous dNMP.

Base Sequence↗

PubMed1991

Transcribed sequences of the Escherichia coli btuB gene control its expression and regulation by vitamin B12.

The Escherichia coli btuB gene product is an outer membrane protein required for the active transport of vitamin B12 and other cobalamins. Synthesis of BtuB is repressed when cells are grown in the presence of cobalamins. Mapping of the 5' end of the btuB transcript revealed that a 240-nucleotide transcribed leader precedes the coding sequence. Point mutations causing increased expression under repressing conditions were isolated by use of a btuB-lacZ gene fusion. Mutations at many sites within the leader region affected btuB-lacZ regulation, whereas some base changes upstream of the start of transcription affected the absolute level of expression but not its repressibility. Analysis of btuB-phoA gene fusions and btuB-lacZ operon and gene fusions of various lengths showed that sequences within the btuB coding region (between nucleotides +250 and +350) had to be present for proper expression and transcriptional regulation. Sequences within the leader region (up to +250) conferred regulation of translational fusions. These results indicate that btuB expression is controlled at both the transcriptional and translational levels and that different but possibly overlapping sequences in the transcribed region, including the coding region for the transport protein itself, mediate these two modes of regulation.

Amino Acid Sequence↗

PubMed1987

Bacillus subtilis phage SPR codes for a DNA methyltransferase with triple sequence specificity.

SPR, a temperate Bacillus subtilis phage, codes for a DNA methyltransferase that can methylate the sequences GGCC (or GGCC) and CCGG at the cytosines indicated. We show here that it can also methylate the sequence CC(A/T)GG and protect it from cleavage with EcoRII and ApyI. This methylation can be seen in vivo as well as in vitro with purified SPR methyltransferase. SPR19 and SPR83 are two mutant phages, defective in GGCC or CCGG methylation, respectively. These mutants have not lost their ability to methylate CC(A/T)GG sites. Mutation SPR26 has lost the ability to methylate all three sites. Thus the SPR methyltransferase codes for three genetically distinguishable methylation abilities.

5-Methylcytosine↗

PubMed1995

Missense mutations that alter the DNA-binding domain of the MtrR protein occur frequently in rectal isolates of Neisseria gonorrhoeae that are resistant to faecal lipids.

Resistance of Neisseria gonorrhoeae to structurally diverse hydrophobic agents (HAs) has been associated with missense or deletion mutations in the mtrR (multiple transferable resistance Regulator) gene of laboratory-derived strains but their prevalence in clinical isolates was heretofore unknown. Since faecal lipids provide strong selective pressure for the emergence of variants resistant to HAs (HAR), the nucleotide sequence of the mtrR gene from rectal isolates of N. gonorrhoeae, which displayed different levels of HAR, was determined. Compared to the mtrR gene possessed by the HA-sensitive strain FA19, each clinical isolate contained mutations in the coding and/or promoter regions of their mtrR gene. A missense mutation in codon 45 (Gly-45 to Asp) was the most common mutation found in the strains studied and impacted the structure of the helix-turn-helix domain of the MtrR protein thought to be important in DNA-binding activity. Two clinical isolates bearing a missense mutation in codon 45 also contained a single basepair deletion in a 13 bp inverted sequence positioned within the mtrR promoter region. Introduction of mtrR sequences amplified from the clinical isolates into strain FA19 revealed that acquisition of the single basepair deletion was correlated with high level HAR while mutations in the mtrR-coding region provided for an intermediate level of HAR.

Amino Acid Sequence↗

PubMed1995

Sequence analysis of flanking regions of the pfoA gene of Clostridium perfringens: beta-galactosidase gene (pbg) is located in the 3'-flanking region.

The 3'-flanking region of the perfringolysin O (theta-toxin) gene (pfoA) of Clostridium perfringens was analyzed by chromosome walking. A total of 5,363 bp of the downstream region of the pfoA gene was sequenced and four open reading frames were found. ORF54 and ORF80 were found to be homologous to genes coding for membrane-bound transporter proteins of other bacteria and the beta-galactosidase gene (bgaB) of Bacillus stearothermophilus, respectively. ORF80 was named the pbg gene. Clones which showed beta-galactosidase activities were selected from a lambda FIXII genomic library of C. perfringens by blue plaque screening using X-Gal as a substrate. Four clones whose plaques showed blue appearances were obtained. Two of the four clones hybridized with the pbg probe but the others did not, indicating that there are two distinct beta-galactosidase genes in C. perfringens. The pbg gene was subcloned into pBR322 and was successfully expressed in Escherichia coli, suggesting that the pbg gene codes for a beta-galactosidase of C. perfringens.

Amino Acid Sequence↗

PubMed1991

Analysis of the complex transcription termination region of the Escherichia coli rrnB gene.

The complex terminator region of the Escherichia coli rrnB gene was analyzed by subcloning the terminators T1 and T2 and the inverted repeats IR1 and IR2 individually, or in various combinations, in a normal or inverted orientation into a terminator probe vector. The in vivo terminating efficiency was assayed by measuring the galactokinase activity encoded by the downstream galK gene. Termination efficiencies of all fragments were compared in two constructs, differing in the presence or absence of readthrough translation over the investigated terminator signal. The following main conclusions were drawn. (a) T1 and T2 are both efficient terminators in isolated forms. (b) IR1 and IR2 have some terminating effect (much lower than the proper terminators), especially in the inverted orientation. Their presence modifies the effect of the proper terminators in a quite unpredictable way, especially if these regions are translated. (c) The terminators are not symmetrical; in the inverted orientation T1 is practically inactive and T2 termination is reduced. (d) Translation radically decreases the efficiency of the terminators. (e) Several sequences in the rrnB gene, upstream of the terminator region (one in the 16S RNA and one in the 5S RNA coding region), are very efficient in vivo terminators in the inverted orientation.

Base Sequence↗

PubMed1989

Comparative analysis of the structures of the outer membrane protein P1 genes from major clones of Haemophilus influenzae type b.

P1 outer membrane proteins from Haemophilus influenzae type b are heterogeneous antigenically and with respect to apparent molecular weight in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. For determination of the molecular basis for the differences in the P1 proteins, the genes for the P1 proteins from strain 1613, representative of outer membrane protein subtype 3L, and strain 8358, representative of outer membrane protein subtype 6U, were cloned, sequenced, and compared with the previously reported gene for the P1 protein from strain MinnA, a strain with the outer membrane protein subtype 1H. These prototype strains are representatives of the three major clonal families of H. influenzae type b responsible for invasive disease in diverse areas of the world. The nucleotide sequences of the P1 genes from strains 1613 and 8358 were 94 and 90% identical to the MinnA sequence, respectively. The derived amino acid sequences were 91 and 86% identical, respectively. Heterogeneity between the MinnA and 1613 proteins was largely localized to two short variable regions; the protein from strain 8538 contained a third variable region not observed in the other P1 proteins. Thus, the outer membrane protein P1 genes are highly conserved; the variable regions may code for the previously demonstrated strain-specific antigenic determinants.

Amino Acid Sequence↗

PubMed1997

Cloning and characterization of two immunophilin-like genes, ilpA and fkpA, on a single 3.9-kilobase fragment of Aeromonas hydrophila genomic DNA.

Antiserum to Aeromonas hydrophila A6 cell envelopes was shown in a previous study (C. Y. F. Wong, G. Mayrhofer, M. W. Heuzenroeder, H. M. Atkinson, D. M. Quinn, and R. L. P. Flower, FEMS Immunol. Med. Microbiol. 15:233-241, 1996) to protect mice against lethal infection by this organism. In this study, colony blot analysis of an A. hydrophila genomic library using antiserum to A. hydrophila A6 cell envelopes revealed a cosmid clone expressing a 30-kDa protein which has not been described previously in aeromonads. The nucleotide sequence of a 3.9-kb fragment derived from this cosmid which expressed the 30-kDa protein revealed two potential open reading frames (ORFs) with homology to known immunophilin proteins. ORF1 encoded a 212-amino-acid protein (molecular mass, 22.4 kDa) with 56% identity to the immunophilin SlyD protein of Escherichia coli. ORF1 was subsequently designated ilpA (immunophilin-like protein). ORF3 encoded a potential gene product of 268 amino acids with a typical signal sequence and a predicted molecular size of 28.7 kDa. The inferred amino acid sequence showed 46% identity with the sequence of the FkpA protein of E. coli and 40% identity with the sequence of the macrophage infectivity potentiator (Mip) protein of Legionella pneumophila. ORF3 was designated fkpA (FK506 binding protein) by analogy with the E. coli FkpA protein. Expression of the FkpA protein was confirmed by Western blot (immunoblot) analysis, which detected a 30-kDa protein, with antiserum to the Mip protein of Legionella longbeachae and a specific antiserum to anA. hydrophila 30-kDa membrane protein. PCR and Southern analysis showed that a DNA sequence encoding FkpA was found in all 178 aeromonads of diverse origins tested. A nonpolar insertion mutation in the fkpA gene did not attenuate virulence in a suckling mouse model nor did it affect the expression of hemolysins or DNase. This suggests that either the fkpA gene is not essential in the virulence of A. hydrophila under these conditions or there are other genes in A. hydrophila coding for proteins with similar functions.

Aeromonas hydrophila↗

PubMed1987

Partial characterization of a low molecular weight human collagen that undergoes alternative splicing.

A cDNA library prepared from RNA isolated from a cultured human tumor cell line, HT-1080, was screened with a mouse cDNA clone coding for part of the -Gly-Xaa-Yaa- domain of the alpha 2(IV) collagen chain. Four overlapping cDNA clones were characterized that coded for a low molecular weight human collagen. The cDNA clones did not, however, code for the short-chain collagens, types IX and X. The amino acid sequences derived from the clones resembled type IV collagen in that there were short interruptions in the repeating -Gly-Xaa-Yaa- sequence. The noncollagenous, carboxyl-terminal domain was, however, much shorter and contained only 18 amino acid residues. Interestingly, one of the cDNA clones contained an additional 36 nucleotides not found in an overlapping clone. The 36 nucleotides encoded four -Gly-Xaa-Yaa- repeats without changing the reading frame. Nuclease S1 mapping demonstrated that the difference between the clones was due to existence of two different mRNAs. A synthetic 24-residue peptide corresponding to the last two -Gly-Xaa-Yaa- triplets and the entire carboxyl-terminal domain was used to generate polyclonal antibodies. Electrophoretic transfer blot analysis of HT-1080 cells and normal human skin fibroblasts identified two polypeptides, Mr 67,000 and Mr 62,000, that were sensitive to bacterial collagenase.

Amino Acid Sequence↗

PubMed1984

Essential site for growth rate-dependent regulation within the Escherichia coli gnd structural gene.

Expression of gnd of Escherichia coli, which encodes the hexose monophosphate shunt enzyme, 6-phosphogluconate dehydrogenase (6PGD; EC 1.1.1.44), is subject to growth rate-dependent regulation: the level of the enzyme is directly proportional to growth rate under a variety of growth conditions. Previous results obtained with strains carrying transcriptional fusions of gnd to the structural genes of the lactose operon suggested that the growth rate-dependent regulation of gnd expression is at the post-transcriptional level. To characterize the regulation further, we prepared with phage MudII a set of eight independent gnd-lac gene (protein) fusions. We showed through genetic analysis and DNA sequencing that each fusion joint was located within the 6PGD-coding sequence between the first and second base pair of a codon, the reading frame required for production of a hybrid 6PGD-beta-galactosidase. Strains harboring the gnd-lac fusion plasmids produced proteins whose mobility in a NaDodSO4/polyacrylamide gel agreed with the molecular weights predicted from the DNA sequence for the respective hybrid proteins. The level of beta-galactosidase was high and relatively growth rate-independent in the fusion whose fusion joint was at codon 48. The level of beta-galactosidase in the other seven fusion strains whose fusion joints were located further downstream in the 6PGD-coding sequence showed the same dependence on growth rate as 6PGD in a normal strain. beta-Galactosidase levels were not affected by the presence of a gnd+ gene in trans to any of the fusions. The results suggest that all sites necessary for growth rate-dependent regulation of 6PGD level lie in gnd upstream from codon 118 and that an essential site of negative control lies within the coding sequence, between codons 48 and 118.

Amino Acid Sequence↗

PubMed1990

The 26S rRNA binding ribosomal protein equivalent to bacterial protein L11 is encoded by unspliced duplicated genes in Saccharomyces cerevisiae.

Transformant phages expressing L15, a yeast ribosomal protein which binds to 26S rRNA and interacts with the acidic ribosomal proteins, were isolated by screening a yeast cDNA expression library in lambda gt11 with specific monoclonal antibodies. Using yeast DNA HindIII fragments that hybridize with the cDNA insert from the L15-expressing clones, minilibraries were prepared in pUC18, which were afterward screened with the same cDNA probe. In this way, plasmids carrying two different types of genomic DNA inserts were obtained. The inserts were subcloned and sequenced and we found a similar coding sequence in both cases flanked by 5' and 3' regions with very low homology. Sequences homologous to the consensus TUF-binding UAS boxes are present in the 5' flanking regions of both genes. Southern analysis revealed the presence of two copies of the L15 gene in the Saccharomyces cerevisiae genome, which are located in different chromosomes. The encoded amino acid sequence corresponds, as expected, to protein L15 and shows a high similarity to bacterial ribosomal protein L11.

Amino Acid Sequence↗

PubMed1986

Characterization of foot-and-mouth disease virus gene products with antisera against bacterially synthesized fusion proteins.

Defined segments of the cloned foot-and-mouth disease virus genome corresponding to all parts of the coding region were expressed in Escherichia coli as fusions to the N-terminal part of the MS2-polymerase gene under the control of the inducible lambda PL promoter. All constructs yielded large amounts of proteins, which were purified and used to raise sequence-specific antisera in rabbits. These antisera were used to identify the corresponding viral gene products in 35S-labeled extracts from foot-and-mouth disease virus gene products in the nucleotide sequence, to identify precursor-product relationships, and to detect several foot-and-mouth disease virus gene products not previously identified in vivo or in vitro.

Animals↗

PubMed2001

The cell division genes ftsQ and ftsZ, but not the three downstream open reading frames YFIH, ORF5 and ORF6, are essential for growth and viability in Brevibacterium lactofermentum ATCC 13869.

The three ORFs (YFIH, ORF5 and ORF6) located downstream of the cell division genes ftsQ and ftsZ in Brevibacterium lactofermentum were disrupted by single homologous recombination events between internal fragments of the corresponding genes and the chromosomal sequences. The phenotypes of the disrupted mutants were similar to that of the wild type, suggesting that these genes are dispensable for growth and viability. However, using different plasmid constructs, it was not possible to obtain disrupted ftsZ or ftsQ mutants by single crossover events. When the ftsZ or ftsQ gene sequence was disrupted in vitro and used to replace the homologous chromosomal gene by double recombination, only single recombination events took place, and therefore no disruptants were obtained. It may be concluded therefore that, as in Escherichia coli, the cell division genes ftsQ and ftsZ are indispensable for growth and viability of B. lactofermentum. Northern hybridisation analyses performed using internal fragments of the genes coding for YFIH, ORF5 and ORF6 allowed us to dissect their transcriptional organization and to confirm the disruption of these genes.

Bacterial Adhesion↗

PubMed1993

Bradyrhizobium japonicum TlpA, a novel membrane-anchored thioredoxin-like protein involved in the biogenesis of cytochrome aa3 and development of symbiosis.

We report the discovery of a bacterial gene, tlpA, that codes for a hitherto unknown type of thioredoxin-like protein. The gene was found in the course of studying a Tn5 insertion mutant of the soybean root nodule symbiont Bradyrhizobium japonicum. The TlpA protein shared up to 31% amino acid sequence identity with various eukaryotic and prokaryotic thioredoxins and protein disulfide isomerases, and possessed a characteristic active-site sequence, Trp-Cys-Val-Pro-Cys. In contrast to all members of the thioredoxin family known to date, TlpA was shown to be anchored to the cytoplasmic membrane by means of an N-terminal transmembrane domain, while the active site-containing part of the protein faced the periplasm. The tlpA mutant had a pleiotropic phenotype in that it was defective in the development of a nitrogen fixing endosymbiosis and exhibited a strongly decreased oxidase activity, as compared with the wild-type. Holocytochrome aa3 was spectroscopically undetectable in the mutant, whereas the apoprotein of subunit one (CoxA) of this oxidase was still synthesized and incorporated into the cytoplasmic membrane. Since cytochrome aa3 is not a prerequisite for the development of symbiosis, the results suggest that TlpA is involved in at least two independent cellular processes, one of which is an essential periplasmic step in the maturation of cytochrome aa3.

Alkaline Phosphatase↗

PubMed1986

Isolation and sequence of the gene for ferredoxin I from the cyanobacterium Anabaena sp. strain PCC 7120.

The structural gene for ferredoxin I, petF, from the cyanobacterium Anabaena sp. strain PCC 7120 has been isolated from a recombinant lambda library. Mixtures of tetradecanucleotides and heptadecanucleotides, each containing all possible DNA sequences corresponding to two separate regions of the ferredoxin amino acid sequence, were synthesized and used as hybridization probes to identify a genomic clone containing the coding sequence for the petF gene. The sequence of the entire petF coding region and portions of the 3'- and 5'-flanking regions was determined. The DNA sequence of petF suggests that, in contrast to the nucleus-encoded plant protein, cyanobacterial apoferredoxin is not synthesized as a higher-molecular-weight precursor. The Anabaena petF gene is a single-copy gene. During growth on complete medium it was transcribed into a monocistronic mRNA species of approximately 500 bases that initiated 100 base pairs upstream from the petF coding region.

Amino Acid Sequence↗