SEARCH · PubMed Health

Results for “Acidianus”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed2000

Cloning and heterologous expression of a sulfur oxygenase/reductase gene from the thermoacidophilic archaeon Acidianus sp. S5 in Escherichia coli.

A thermoacidophilic, obligately chemolithotrophic, facultatively aerobic archaebacterium, Acidianus sp. S5, was isolated from acidothermal springs in southwest China. The sulfur oxygenase/reductase (SOR) gene of Acidianus sp. S5 was cloned and expressed in Escherichia coli. Several primers were designed and successfully applied for detection and cloning of the sor gene. A 3.7-kb EcoRI fragment containing the sor gene and three neighboring open reading frames was sequenced. Sequence analysis indicated that the sor gene of Acidianus sp. S5 showed 81% identity to the sor gene of Acidianus ambivalens. E. coli cells carrying the sor gene on pBV220SOR were able to overproduce SOR upon a temperature shift from 30 to 42 degrees C. SOR produced in E. coli catalyzes the oxidation of elemental sulfur and concomitant production of sulfite, thiosulfate and hydrogen sulfide. The recombinant enzyme exhibits the same catalytic properties as the one from Acidianus S5.

Amino Acid Sequence↗

PubMed2000

Stability and folding of the ferredoxin from the hyperthermophilic archaeon Acidianus ambivalens.

The ferredoxin from the thermophilic archaeon Acidianus ambivalens is a small monomeric protein containing two iron-sulfur centres, one [3Fe-4S](1+/0) and one [4Fe-4S](2+/1+). It is an intrinsically hyperstable protein, being expressed at the organism's extreme optimal growth temperature: 80 degrees C. Using spectroscopic methods we have investigated the unfolding reaction of the Acidianus ambivalens ferredoxin. No unfolding of the oxidised ferredoxin was observed at pH 7.0, even in the presence of 8 M GuHCl. Upon increasing the pH to 10.0, the unfolding transition showed a midpoint at 6.3 M GuHCl and an unfolding-free energy of 70 kJ mol(-1) in buffer (pH 10) was estimated. Kinetic-unfolding experiments showed that the polypeptide unfolding correlated with rearrangement of the iron-sulfur centres to new ones which had strong absorption maxima at 520 and 610 nm. These new, possibly linear three-iron, clusters were coordinated to the unfolded protein but degraded slowly. From thermal experiments in the presence of GuHCl we estimated the melting temperature for the Acidianus ambivalens ferredoxin in buffer (at pH 7) to be 122 degrees C. Possible structural properties that contribute to the large thermal stability of the Acidianus ambivalens ferredoxin are discussed using a three-dimensional protein model.

Archaea↗

PubMed2004

Acidianus tengchongensis sp. nov., a new species of acidothermophilic archaeon isolated from an acidothermal spring.

A new thermoacidophilic, obligately chemolithotrophic, facultatively aerobic archaeon Acidianus S5(T), was isolated from a Tengchong acidothermal spring in southwestern China. It is a Gram-negative, nonmotile, irregular coccoid organism with a cell diameter of 1.2 microm. The optimal pH and temperature for growth are 2.5 and 70 degrees C, respectively. Under anaerobic conditions, the organism reduces elemental sulfur with molecular hydrogen, producing hydrogen sulfide. Under aerobic conditions, it oxidizes elemental sulfur and produces sulfuric acid. No growth occurs when it is cultivated in an iron medium, indicating that ferrous iron cannot serve as an energy source. The G+C content is 38% (mol/mol), which is much different from that of other Acidianus species (31%-32.7%). The phylogenetic distances, based on 16S rDNA sequences, to A. brierleyi, A. infernus, and A. ambivalens were 0.2, 2.6, and 2.5%, respectively. DNA-DNA hybridization rates of strain S5(T) to A. brierleyi, A. infernus, and A. ambivalens are 44, 22, and 23%, respectively. Thus, a new name, Acidianus tengchongensis sp. nov., is proposed for this strain S5(T).

Acidianus↗

PubMed2006

Acidianus manzaensis sp. nov., a novel thermoacidophilic archaeon growing autotrophically by the oxidation of H2 with the reduction of Fe3+.

A novel thermoacidophilic iron-reducing Archaeon, strain NA-1, was isolated from a hot fumarole in Manza, Japan. Strain NA-1 could grow autotrophically using H2 or S0 as an electron donor and Fe3+ as an electron acceptor, and also could grow heterotrophically using some organic compounds. Fe3+ and O2 served as electron acceptors for growth. However, S0, NO3-, NO2-, SO4(2-), Mn4+, fumarate, and Fe2O3 did not serve as electron acceptors. The ranges of growth temperature and pH were 60-90 degrees C (optimum: 80 degrees C) and pH 1.0-5.0 (optimum: pH 1.2-1.5), respectively. Cells were nearly regular cocci with an envelope comprised of the cytoplasmic membrane and a single outer S-layer. The crenarchaeal-specific quinone (cardariellaquinone) was detected, and the genomic DNA G + C content was 29.9 mol%. From 16S rDNA analysis, it was determined that strain NA-1 is closely related to Acidianus ambivalens (93.1%) and Acidianus infernus (93.0%). However, differences revealed by phylogenetic and phenotypic analyses clearly show that strain NA-1 represents a new species, Acidianus manzaensis, sp. nov., making it the first identified thermoacidophilic iron-reducing microorganism (strain NA-1T = NBRC 100595 = ATCC BAA 1057).

Acidianus↗

PubMed2003

Purification and properties of the sulfur oxygenase/reductase from the acidothermophilic archaeon, Acidianus strain S5.

The sulfur oxygenase/reductase (SOR) of Acidianus strain S5 was purified and characterized after expressing the SOR gene in a recombinant strain of Escherichia coli. The N-terminal sequence of the purified SOR protein was the same as the deduced amino acid sequence from previously cloned SOR genes. Enzymatic studies indicated that the SOR catalyzed the conversion of elemental sulfur (S(o)) to sulfite, thiosulfate, and sulfide. The optimal pH and temperature were 5.0 and 70 degrees C, respectively. Comparison of this SOR and that of A. ambivalens revealed several differences between these two SORs. The most striking difference is that the SOR of Acidianus S5 had maximal activity at acidic pH. By application of anti-SOR serum and the Western blot technique, it was found that SOR proteins existed in A. brierleyi and in Acidianus S5 cells cultivated with thiosulfate as the sole energy source, indicating that SOR may also play a role in thiosulfate metabolism.

Acidianus↗

PubMed2003

AFV1, a novel virus infecting hyperthermophilic archaea of the genus acidianus.

We describe a novel virus, AFV1, of the hyperthermophilic archaeal genus Acidianus. Filamentous virions are covered with a lipid envelope and contain at least five different proteins with molecular masses in the range of 23-130 kDa and a 20.8-kb-long linear double-stranded DNA. The virus has been assigned to the family Lipothrixviridae on the basis of morphotypic characteristics. Host range is confined to several strains of Acidianus and the virus persists in its hosts in a stable carrier state. The latent period of virus infection is about 4 h. Viral DNA was sequenced and sequence similarities were found to the lipothrixvirus SIFV, the rudiviruses SIRV1 and SIRV2, as well as to conjugative plasmids and chromosomes of the genus Sulfolobus. Exceptionally for the linear genomes of archaeal viruses, many short direct repeats, with the sequence TTGTT or close variants thereof, are closely clustered over 300 bp at each end of the genome. They are reminiscent of the telomeric ends of linear eukaryal chromosomes.

Acidianus↗

PubMed2004

The sulphur oxygenase reductase from Acidianus ambivalens is a multimeric protein containing a low-potential mononuclear non-haem iron centre.

The SOR (sulphur oxygenase reductase) is the initial enzyme in the sulphur-oxidation pathway of Acidianus ambivalens. Expression of the sor gene in Escherichia coli resulted in active, soluble SOR and in inclusion bodies from which active SOR could be refolded as long as ferric ions were present in the refolding solution. Wild-type, recombinant and refolded SOR possessed indistinguishable properties. Conformational stability studies showed that the apparent unfolding free energy in water is approx. 5 kcal x mol(-1) (1 kcal=4.184 kJ), at pH 7. The analysis of the quaternary structures showed a ball-shaped assembly with a central hollow core probably consisting of 24 subunits in a 432 symmetry. The subunits form homodimers as the building blocks of the holoenzyme. Iron was found in the wild-type enzyme at a stoichiometry of one iron atom/subunit. EPR spectroscopy of the colourless SOR resulted in a single isotropic signal at g=4.3, characteristic of high-spin ferric iron. The signal disappeared upon reduction with dithionite or incubation with sulphur at elevated temperature. Thus both EPR and chemical analysis indicate the presence of a mononuclear iron centre, which has a reduction potential of -268 mV at pH 6.5. Protein database inspection identified four SOR protein homologues, but no other significant similarities. The spectroscopic data and the sequence comparison led to the proposal that the Acidianus ambivalens SOR typifies a new type of non-haem iron enzyme containing a mononuclear iron centre co-ordinated by carboxylate and/or histidine ligands.

Acidianus↗

PubMed2003

Membrane-bound hydrogenase and sulfur reductase of the hyperthermophilic and acidophilic archaeon Acidianus ambivalens.

A sulfur reductase (SR) and a hydrogenase were purified from solubilized membrane fractions of anaerobically grown cells of the sulfur-dependent archaeon Acidianus ambivalens and the corresponding genes were sequenced. The SR reduced elemental sulfur with hydrogen as electron donor [45 U (mg protein)(-1)] in the presence of hydrogenase and either 2,3-dimethylnaphthoquinone (DMN) or cytochrome c in the enzyme assay. The SR could not be separated from the hydrogenase during purification without loss of activity, whereas the hydrogenase could be separated from the SR. The specific activity of the hydrogenase was 170 U (mg protein)(-1) with methyl viologen and 833 U (mg protein)(-1) with DMN as electron acceptors. Both holoenzymes showed molecular masses of 250 kDa. In SDS gels of active fractions, protein bands with apparent masses of 110 (SreA), 66 (HynL), 41 (HynS) and 29 kDa were present. Enriched hydrogenase fractions contained 14 micro mol Fe and 2 micromol Ni (g protein)(-1); in addition, 2.5 micromol Mo (g protein)(-1) was found in the membrane fraction. Two overlapping genomic cosmid clones were sequenced, encoding a five-gene SR cluster (sre) including the 110 kDa subunit gene (sreA), and a 12-gene hydrogenase cluster (hyn) including the large and small subunit genes and genes encoding proteins required for the maturation of NiFe hydrogenases. A phylogenetic analysis of the SR amino acid sequence revealed that the protein belonged to the DMSO reductase family of molybdoenzymes and that the family showed a novel clustering. A model of sulfur respiration in Acidianus developed from the biochemical results and the data of the amino acid sequence comparisons is discussed.

Acidianus↗

PubMed2005

Viral diversity in hot springs of Pozzuoli, Italy, and characterization of a unique archaeal virus, Acidianus bottle-shaped virus, from a new family, the Ampullaviridae.

Virus-like particles with five different morphotypes were observed in an enriched environmental sample from a hot, acidic spring (87 to 93 degrees C, pH 1.5) in Pozzuoli, Italy. The morphotypes included rigid rods, flexible filaments, and novel, exceptional forms. Particles of each type were isolated, and they were shown to represent viable virions of five novel viruses which infect members of the hyperthermophilic archaeal genus Acidianus. One of these, named the Acidianus bottle-shaped virus, ABV, exhibits a previously unreported morphotype. The bottle-shaped virion carries an envelope which encases a funnel-shaped core. The pointed end of the virion is likely to be involved in adsorption and channeling of viral DNA into host cells. The broad end exhibits 20 (+/- 2) thin filaments which appear to be inserted into a disk, or ring, and are interconnected at their bases. These filaments are apparently not involved in adsorption. ABV virions contain six proteins in the size range 15 to 80 kDa and a 23.9-kb linear, double-stranded DNA genome. Virus replication does not cause lysis of host cells. On the basis of its unique morphotype and structure, we propose to assign ABV to a new viral family, the Ampullaviridae.

Acidianus↗

PubMed1999

The unusual iron sulfur composition of the Acidianus ambivalens succinate dehydrogenase complex.

The succinate dehydrogenase complex of the thermoacidophilic archaeon Acidianus ambivalens was investigated kinetically and by EPR spectroscopy in its most intact form, i.e., membrane bound. Here it is shown that this respiratory complex has an unusual iron-sulfur cluster composition in respect to that of the canonical succinate dehydrogenases known. The spectroscopic studies show that center S3, the succinate responsive [3Fe-4S]1+/0 cluster of succinate dehydrogenases, is not present in membranes prepared from aerobically grown A. ambivalens, nor in partially purified complex fractions. On the other hand, EPR features associated to the remaining centers, clusters S1 ([2Fe-2S]1+/2+) and S2 ([4Fe-4S]2+/1+), could be observed. Similar findings were made in other archaea, namely Acidianus infernus and Sulfolobus solfataricus. Kinetic investigations showed that the A. ambivalens enzyme is reversible, capable of operating as a fumarate reductase - a required activity if this obligate autotroph performs CO2 fixation via a reductive citric acid cycle. Sequencing of the sdh operon confirmed the spectroscopic data. Center S3 ([3Fe-4S]) is indeed replaced by a second [4Fe-4S] center, by incorporation of an additional cysteine, at the cysteine cluster binding motif (CxxYxxCxxxC-->CxxCxxCxxxC). Genomic analysis shows that genes encoding for succinate dehydrogenases similar to the ones here outlined are also present in bacteria, which may indicate a novel family of succinate/fumarate oxidoreductases, spread among the Archaea and Bacteria domains.

Amino Acid Sequence↗

PubMed2001

A new type-II NADH dehydrogenase from the archaeon Acidianus ambivalens: characterization and in vitro reconstitution of the respiratory chain.

A new type-II NADH dehydrogenase (NDH-II) was isolated from the hyperthermoacidophilic archaeon Acidianus ambivalens. This enzyme is a monomer with an apparent molecular mass of 47 kDa, containing a covalently bound flavin, and no iron-sulfur clusters. Upon isolation, NDH-II loses activity, which can, nevertheless, be restored by incubation with phospholipids. Catalytically, it is a proficient NADH:caldariella quinone oxidoreductase (130 mmol NADH oxidized/mg protein(-1)/min(-1)) but it can also donate electrons to synthetic quinones, strongly suggesting its involvement in the respiratory chain. The apparent Km for NADH was found to be approximately 6 microM, both for the purified and membrane-integrated enzyme, thus showing that detergent solubilization and purification did not affect the substrate binding site. Further, it is the first example of a type-II NADH dehydrogenase that contains the flavin covalently attached, which may be related to the need to stabilize the otherwise labile cofactor in a thermophilic environment. A fully operative minimal version of Acidianus ambivalens respiratory system was successfully reconstituted into artificial liposomes, using three basic components isolated from the organism: the type-II NADH dehydrogenase, caldariella quinone, the organism-specific quinone, and the aa3 type quinol oxidase. This system, which mimics the in vivo chain, is efficiently energized by NADH, driving oxygen consumption by means of the terminal oxidase.

Amino Acid Sequence↗

PubMed2005

Structure and coordination of CuB in the Acidianus ambivalens aa3 quinol oxidase heme-copper center.

The coordination environment of the Cu(B) center of the quinol oxidase from Acidianus ambivalens, a type B heme-copper oxygen reductase, was investigated by Fourier transform (FT) IR and extended X-ray absorption fine structure (EXAFS) spectroscopy. The comparative structural chemistry of dinuclear Fe-Cu sites of the different types of oxygen reductases is of great interest. Fully reduced A. ambivalens quinol oxidase binds CO at the heme a (3) center, with nu(CO)=1,973 cm(-1). On photolysis, the CO migrated to the Cu(B) center, forming a Cu (B) (I) -CO complex with nu(CO)=2,047 cm(-1). Raising the temperature of the samples to 25 degrees C did not result in a total loss of signal in the FTIR difference spectrum although the intensity of these signals was reduced sevenfold. This observation is consistent with a large energy barrier against the geminate rebinding of CO to the heme iron from Cu(B), a restricted limited access at the active-site pocket for a second binding, and a kinetically stable Cu(B)-CO complex in A. ambivalens aa (3). The Cu(B) center was probed in a number of different states using EXAFS spectroscopy. The oxidized state was best simulated by three histidines and a solvent O scatterer. On reduction, the site became three-coordinate, but in contrast to the bo (3) enzyme, there was no evidence for heterogeneity of binding of the coordinated histidines. The Cu(B) centers in both the oxidized and the reduced enzymes also appeared to contain substoichiometric amounts (0.2 mol equiv) of nonlabile chloride ion. EXAFS data of the reduced carbonylated enzyme showed no difference between dark and photolyzed forms. The spectra could be well fit by 2.5 imidazoles, 0.5 Cl(-) and 0.5 CO ligands. This arrangement of scatterers would be consistent with about half the sites remaining as unligated Cu(his)(3) and half being converted to Cu(his)(2)Cl(-)CO, a 50/50 ratio of Cu(his)(2)Cl(-) and Cu(his)(3)CO, or some combination of these formulations.

Acidianus↗

PubMed2004

Active site structure of the aa3 quinol oxidase of Acidianus ambivalens.

The membrane bound aa(3)-type quinol:oxygen oxidoreductase from the hyperthermophilic archaeon, Acidianus ambivalens, which thrives at a pH of 2.5 and a temperature of 80 degrees C, has several unique structural and functional features as compared to the other members of the heme-copper oxygen reductase superfamily, but shares the common redox-coupled, proton-pumping function. To better understand the properties of the heme a(3)-Cu(B) catalytic site, a resonance Raman spectroscopic study of the enzyme under a variety of conditions and in the presence of various ligands was carried out. Assignments of several heme vibrational modes as well as iron-ligand stretching modes are made to serve as a basis for comparing the structure of the enzyme to that of other oxygen reductases. The CO-bound oxidase has conformations that are similar to those of other oxygen reductases. However, the addition of CO to the resting enzyme does not generate a mixed valence species as in the bovine aa(3) enzyme. The cyanide complex of the oxidized enzyme of A. ambivalens does not display the high stability of its bovine counterpart, and a redox titration demonstrates that there is an extensive heme-heme interaction reflected in the midpoint potentials of the cyanide adduct. The A. ambivalens oxygen reductase is very stable under acidic conditions, but it undergoes an earlier alkaline transition than the bovine enzyme. The A. ambivalens enzyme exhibits a redox-linked reversible conformational transition in the heme a(3)-Cu(B) center. The pH dependence and H/D exchange demonstrate that the conformational transition is associated with proton movements involving a group or groups with a pK(a) of approximately 3.8. The observed reversibility and involvement of protons in the redox-coupled conformational transition support the proton translocation model presented earlier. The implications of such conformational changes are discussed in relation to general redox-coupled proton pumping mechanisms in the heme-copper oxygen reductases.

Acidianus↗

PubMed2004

The sulfur oxygenase reductase from Acidianus ambivalens is an icosatetramer as shown by crystallization and Patterson analysis.

The sulfur oxygenase reductase (SOR) is the initial enzyme in the aerobic sulfur metabolism of the thermoacidophilic and chemolithoautotrophic crenarchaeote Acidianus ambivalens. Single colorless polyhedral crystals were obtained under two crystallization conditions from SOR preparations heterologously overproduced in Escherichia coli. They belonged to space-group I4 and diffraction data were collected up to 1.7 A resolution. Their Patterson symmetry shows additional 4-, 3- and 2-fold non-crystallographic symmetry rotation axes, characteristic of the point group 432. Taking into account the molecular mass of SOR, the crystal unit cell volume, the non-crystallographic symmetry operators and previous electron microscopy studies of the SOR, it was deduced that the quaternary structure of the functionally active enzyme is an icosatetramer with 871 kDa molecular mass.

Acidianus↗

PubMed2005

Crystallisation and preliminary structure determination of a NADH: quinone oxidoreductase from the extremophile Acidianus ambivalens.

NADH:quinone oxidoreductases (NDHs), constitute one of the electron entry points into membrane-bound respiratory chains, oxidising NADH and reducing quinones. Type-II NDHs (NDH-2) are functionally unable to translocate protons and are typically constituted by a single approximately 50 kDa subunit lacking iron-sulfur clusters and containing one flavin as the sole redox centre. No three dimensional crystal structure is yet available for NDHs. We describe the crystallisation and preliminary structure determination of a NDH-2 that contains a covalently bound FAD, isolated from the membrane fraction of Acidianus ambivalens, a hyperthermoacidophilic archaeon capable of growing at 80 degrees C and pH 2.0. NDH-2 was solubilised with the detergent n-dodecyl-beta-d-maltoside and crystallised using ammonium phosphate as precipitant. The structure was solved by MIRAS using Pt and I derivatives.

Acidianus↗

PubMed2005

Identification of core active site residues of the sulfur oxygenase reductase from Acidianus ambivalens by site-directed mutagenesis.

The sulfur oxygenase reductase (SOR) is the initial enzyme in the sulfur oxidation pathway of Acidianus ambivalens. The SOR is composed of 308 aa residues, three of which are cysteines, and contains a mononuclear non-heme iron site. Mutations of the suspected iron-binding residues H86, H90 and E114 to alanine resulted in inactive enzyme with no iron incorporated, whereas an E114D mutant showed 1% of wild type activity. The mutation of C31 to alanine and serine caused inactivity of the enzyme, however, the iron content was the same as in the wild type. C101A, C104S/A, and C101/104S/A double mutants caused a decrease in specific activity to 10-43% of the wild type while the C101S mutant showed only 1% activity of the wild type. The drop in activity of the C101S and E114D mutants was accompanied with a proportional decrease in iron content. In all cases the oxygenase and reductase partial reactions were equally affected. It was concluded that the Fe site with H86, H90 and E114 as ligands and C31 constitute the core active site whereas C101 and C104 optimize reaction conditions.

Acidianus↗

PubMed2005

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

Acidianus↗

PubMed2005

Key role of cysteine residues in catalysis and subcellular localization of sulfur oxygenase-reductase of Acidianus tengchongensis.

Analysis of known sulfur oxygenase-reductases (SORs) and the SOR-like sequences identified from public databases indicated that they all possess three cysteine residues within two conserved motifs (V-G-P-K-V-C(31) and C(101)-X-X-C(104); numbering according to the Acidianus tengchongensis numbering system). The thio-modifying reagent N-ethylmaleimide and Zn(2+) strongly inhibited the activities of the SORs of A. tengchongensis, suggesting that cysteine residues are important. Site-directed mutagenesis was used to construct four mutant SORs with cysteines replaced by serine or alanine. The purified mutant proteins were investigated in parallel with the wild-type SOR. Replacement of any cysteine reduced SOR activity by 98.4 to 100%, indicating that all the cysteine residues are crucial to SOR activities. Circular-dichroism and fluorescence spectrum analyses revealed that the wild-type and mutant SORs have similar structures and that none of them form any disulfide bond. Thus, it is proposed that three cysteine residues, C(31) and C(101)-X-X-C(104), in the conserved domains constitute the putative binding and catalytic sites of SOR. Furthermore, enzymatic activity assays of the subcellular fractions and immune electron microscopy indicated that SOR is not only present in the cytoplasm but also associated with the cytoplasmic membrane of A. tengchongensis. The membrane-associated SOR activity was colocalized with the activities of sulfite:acceptor oxidoreductase and thiosulfate:acceptor oxidoreductase. We tentatively propose that these enzymes are located in close proximity on the membrane to catalyze sulfur oxidation in A. tengchongensis.

Acidianus↗