SEARCH · PubMed Health

Results for “Alfalfa”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed1979

Comparative effects of alfalfa saponins and alfalfa fiber on cholesterol absorption in rats.

Intestinal absorption of cholesterol was measured in control rats fed semipurified diets and in rats fed alfalfa meal, in which saponins had been previously extracted, or this extracted material plus alfalfa saponins. A dose of 2 mg radioactive cholesterol was administered intragastrically, and fecal excretion of labeled neutral steroids measured. Absorption of cholesterol was about 76% in control animals, and about 47% in alfalfa-red rats. Extraction of saponins from alfalfa eliminated the cholesterol absorption-lowering effect, while addition of 0.26% alfalfa saponins to the extracted alfalfa restored its activity. The results demonstrate that alfalfa saponins are responsible for the effect of alfalfa meal in reducing cholesterol absorption, and that alfalfa fiber is not involved in this activity.

Animals↗

PubMed1978

Effect of alfalfa and dietary fiber on the growth performance of weanling rabbits.

The addition of 10%, 20%, 30%, and 40% sun-cured alfalfa meal to a high-energy, low-fiber, basal diet for weanling rabbits gave increased average daily gains as compared to gain on the basal diet. Deaths from enteritis complex occurred only at the 0% and 10% alfalfa levels. When 2.5%, 5%, 7.5%, and 10% alfalfa meal were used, the average daily gains were numerically higher for all alfalfa-fed groups than for the basal diet. Maximum gains were achieved at the 20% alfalfa level. Alfalfa extracted with 95% ethanol retained its growth-stimulating effect when added to the basal diet. Feed preference trials gave conflicting results. In one trial, the basal diet was preferred over all alfalfa diets in a two-choice feed preference test, while in a second trial, all alfalfa diets were preferred over the basal diet. It was concluded that the growth of weaning rabbits fed a high energy diet was improved by the addition of alfalfa meal.

Animal Feed↗

PubMed2026

The dirigent protein MsDIR6 functions in drought tolerance and modulates reactive oxygen species scavenging and secondary metabolite biosynthesis in alfalfa.

Alfalfa (Medicago sativa L.) is a globally significant forage crop essential for ensuring global food security. However, soil water deficit leads to a substantial decline in its yield, posing a severe threat to sustainable forage production. Dirigent (DIR) proteins play important roles in lignan biosynthesis and plant stress responses. Here, we identified 52 MsDIR genes in alfalfa through a genome-wide analysis, and screened MsDIR6 as a key candidate gene associated with drought tolerance. The results of qRT-PCR showed that MsDIR6 transcription was significantly induced by drought stress in alfalfa. MsDIR6 was preferentially expressed in roots and leaves, and its protein was localized in the nucleus and plasma membrane. Heterologous expression of MsDIR6 in yeast improved tolerance to mannitol-triggered osmotic stress. Heterologous overexpression of MsDIR6 in Arabidopsis significantly increased seed germination rate, seedling survival rate, and antioxidant capacity under drought stress, while improving leaf water-holding capacity by regulating stomatal movement. In transgenic alfalfa hairy roots, MsDIR6 alleviated drought-induced growth inhibition and enhanced reactive oxygen species (ROS) scavenging mediated by the antioxidant defense system under drought stress. Transcriptomic analysis revealed that MsDIR6 activated key genes in the phenylpropanoid and flavonoid biosynthesis pathways, which are crucial for ROS scavenging during drought adaptation. Additionally, we observed elevated flavonoid and lignin contents in MsDIR6-overexpressing alfalfa. Collectively, our findings offer novel insights into alfalfa's drought tolerance mechanisms and identify MsDIR6 as a promising genetic resource for molecular breeding strategies to improve this vital forage crop.

Alfalfa↗

PubMed1979

Calcium-containing crystals in alfalfa: their fate in cattle.

The fate of crystals in the parenchymatous sheaths around vascular bundles in alfalfa leaves was followed through the bovine digestive tract by scanning electron microscopy. The bundle and sheath pass from the rumen largely intact. Most crystals are released from the bundle sheath postruminally. In feces, some crystals appear partially eroded and others are intact. By energy-dispersive x-ray analysis calcium is the primary crystal cation. Intact cyrstals isolated from alfalfa leaves by low-temperature ashing and from bovine feces by washing and differential specific gravity were subjected to Raman microprobe analysis. Most crystals were calcium oxalate, a few were potassium oxalate, and some contained both compounds. From 20 to 33% of calcium in alfalfa is in the form of oxalate and apparently unavailable to ruminants. Carbonate is probably in partially eroded crystals from feces. Data presented account for the poorer utilization by cattle of calcium from alfalfa than that from inorganic sources.

Animals↗

PubMed1979

Effect of dietary alfalfa, pectin, and wheat bran on azoxymethane-or methylnitrosourea-induced colon carcinogenesis in F344 rats.

The effect of dietary alfalfa, pectin, and wheat bran on colon carcinogenesis was studied in female inbred F344 rats. Weanling rats were fed semipurified diets containing 0 or 15% alfalfa, pectin, or wheat bran. At 7 weeks of age, all animals except controls were given azoxymethane (AOM) sc at a dose rate of 8 mg/kg body weight/week for 10 weeks or methylnitrosourea (MNU) intrarectally at a dose rate of 2 mg/rat twice a week for 3 weeks. The AOM-treated group was autopsied 40 weeks and the MNU-treated group 30 weeks after the first injection of the carcinogen. No tumors were observed in the colon or other organs of untreated rats fed the various diets. The animals fed the alfalfa diet and treated with MNU had a higher incidence of colon tumors than did those fed the control diet or the diets containing pectin or wheat bran. The incidence of MNU-induced colon tumors did not differ between the animals fed the control diet or the diets containing pectin or wheat bran. However, the incidence of AOM-induced colon tumors in rats fed diets containing pectin or wheat bran was lower than that in rats fed the control diet or the alfalfa diet. These results thus indicate that the effect of fiber in colon carcinogenesis depends on the type of fiber and, possibly, the fiber's mode of action.

Animals↗

PubMed2025

Whole genome duplication drives transcriptome reprogramming in response to drought in alfalfa.

Genome doubling did not enhance drought tolerance in alfalfa, but may set the stage for long-term adaptation to drought through a novel transcriptional landscape. Whole genome duplication (WGD) has been shown to enhance stress tolerance in plants. Cultivated alfalfa is autotetraploid, but diploid wild relatives are important sources of genetic variation for breeding. Investigating how WGD affects gene expression in stress conditions could provide better understanding for use of diploid genetic resources. In this work, we compared the drought response of neotetraploid plants obtained by bilateral sexual polyploidization with diploid full sibs, by measuring physiological and biochemical traits and RNA-seq. Without drought, 4x plants had lower photosynthetic potential than 2x plants per unit leaf area, but larger leaves allowed them to outperform the per leaf photosynthetic potential of 2x plants. Physiological and biochemical traits were significantly affected by drought in both 2x and 4x plants, but the differences between ploidies were small and nonsignificant. Proline levels were higher in 4x than 2x plants, both in control and drought conditions, indicating that larger cells with higher volume-to-surface ratio of 4x  plants require a higher osmolyte concentration. RNA-seq and gene network analyses showed that more genes were affected by drought at 4x than at 2x level, with downregulation of hundreds of genes involved in photosynthesis and stomatal movement at 4x level, suggesting that WGD made the 4x plants more responsive to drought. Genes involved in proline, phytormone and cell wall functions were also transcriptionally affected by drought in 4x plants. We conclude that WGD did not immediately enhance drought tolerance in alfalfa, but may set the stage for long-term adaptation to drought through a novel transcriptional landscape.

Medicago sativa↗

PubMed1978

Effect of alfalfa meal on shrinkage (regression) of atherosclerotic plaques during cholesterol feeding in monkeys.

A semipurified diet containing 1.2 mg of cholesterol/Cal was fed to cynomolgus monkeys (Macaca fascicularis). At the end of 6 months, a group of 18 animals was killed for evaluation of atherosclerosis in the aorta and the coronary arteries. The remaining monkeys were assigned to three groups of 18 animals each and fed, during the following 18 months, semipurified diets containing 0.34 mg of cholesterol/Cal with or without alfalfa meal, or a diet consisting entirely of Monkey Chow. a decrease in cholesterolemia and plasma phospholipid levels, normalization in the distribution of plasma lipoproteins, and reduction in the extent of aortic and coronary atherosclerosis were observed in monkeys fed the semipurified diet containing alfalfa, although the intake of cholesterol remained as high as in the usual American diet. These changes, also observed in monkeys fed a chow diet almost devoid of cholesterol, suggest that alfalfa counteracts the atherogenic effect of dietary cholesterol.

Animals↗

PubMed1977

Effect of alfalfa saponins on intestinal cholesterol absorption in rats.

Five to 20 mg of saponins obtained from alfalfa tops or roots were introduced intragastrically in rats also receiving oral and intravenous ring-labeled cholesterol. The saponins were tested before and after partial acid hydrolysis. Absorption of cholesterol was determined by estimation of fecal sterols and by a dual isotope technique involving assay of plasma radioactivity. Alfalfa top saponins (nonhydrolyzed) reduced absorption of cholesterol. Acid hydrolysis of alfalfa top or root saponins enhanced their ability to inhibit cholesterol absorption.

Animals↗

PubMed1978

Coat protein binds to the 3'-terminal part of RNA 4 of alfalfa mosaic virus.

All four RNAs of alfalfa mosaic virus contain a limited number of sites with a high affinity for coat protein [Van Boxsel, J. A. M. (1976), Ph.D. Thesis, University of Leiden]. In order to localize these sites in the viral RNAs, RNA 4 Tthe subgenomic messenger for coat protein) was subjected to a very mild digestion with ribonucleast T1. The ten major fragments, apparently resulting from five preferential hits, were separated and tested for messenger activity in a wheat germ cell-free system, as well as for the capacity to withdraw coat protein from intact particles. Fragments which stimulated amino acid incorporation were assumed to contain the 5 terminus. Strong evidence was obtained for the location of sites with a high affinity for coat protein near the 3' terminus. The smallest fragment which has the 3'-terminal cytosine comprises only 10% of the length of intact RNA 4 but still possesses these sites. Evidence is presented that the complete coat protein cistron is in the complementing 90% fragment. Possibly, the high-affinity sites are entirely located in the 3'-terminal extracistronic part of RNA 4. They will have the same position in RNA 3 and, possibly, also in the other parts of the genome of alfalfa mosaic virus. The need of this genome for coat protein in order to become infectious may therefore find its explanation in the fact that a conformational change at the 3' ends of the genome parts brought about by the coat protein is required for recognition by the viral replicase.

Medicago sativa↗

PubMed1977

Initiation of polypeptide synthesis with various NH2-blocked aminoacyl-tRNAs under the direction of alfalfa mosaic virus RNA 4.

Initiation of polypeptide synthesis in a cell-free system of Escherichia coli directed by alfalfa mosaic virus RNA 4 was studied by using either fMet-tRNA or Ac-Phe-tRNA as initiator tRNA. Initiation with fMet-tRNA yielded a product that was identical to the authentic viral coat protein except that the NH2-terminal serine was preceded by fMet instead of being acetylated. When Ac-Phe-tRNA was used as initiator, the biosynthetic product was 10-12 amino acid residues longer, the extra amino acids being located at the NH2-terminus. fMet-tRNA and Ac-Phe-tRNA did not compete for ribosomes during initiation of protein synthesis, as became evident from incorporation studies using both initiator tRNAs simultaneously. It is concluded that E. coli ribosomes recognize two sites on the 5' end of alfalfa mosaic virus RNA 4 that are separated by a region of about 30 nucleotides. The results are in complete agreement with the 5'-terminal nucleotide sequence of this RNA [Koper-Zwarthoff, E. C., Lockhard, R. E., RajBhandary, U. L., Alzner-deWeerd, B. & Bol, J. F. (1977) Proc. Natl. Acad. Sci. USA 74, 5504-5508].

Cell-Free System↗

PubMed2026

Identification of genes promoting fitness of a plant-associated Salmonella Choleraesuis strain on alfalfa sprouts during cold storage.

Consumption of sprouted seeds, such as alfalfa sprouts, has increased in recent years due to their nutritional value and antioxidant content. However, these products have repeatedly been implicated in outbreaks of foodborne pathogens, including Salmonella enterica. Although host-adapted Salmonella serovars are less frequently associated with foodborne illness, infections caused by these serovars often result in invasive and severe outcomes, highlighting the importance of understanding their persistence in food production systems. Moreover, the variability among Salmonella serovars requires characterization beyond the most prevalent types to support the development of precision food safety strategies effective across the diversity of serovars capable of contaminating fresh produce. Here, a plant-internalized Salmonella Choleraesuis strain was used as a model to investigate persistence mechanisms on alfalfa sprouts. A bar-coded transposon mutant library comprising approximately 33,000 unique insertions was generated, along with a collection of individual insertion mutants. These resources were used to identify genetic determinants contributing to strain fitness on sprouts under abusive cold storage (8°C) simulating commercial shelf-life environments. Genome-wide analyses identified negative selection for mutants with insertions in eda, fabF, lpp1_2, pnp, stpA, SCHChr_03621, and two intergenic regions. Competition assays confirmed fitness defects associated with eda, encoding a key enzyme of the Entner-Doudoroff pathway; mnmG, encoding a tRNA modification enzyme involved in translational fidelity; and fabF, involved in fatty acid biogenesis. These findings provide a genome-wide perspective on mechanisms enabling persistence on sprouts of a plant-associated, host-adapted Salmonella strain during cold storage and inform risk assessment and intervention design within precision food safety frameworks.IMPORTANCEFood safety strategies are frequently based on knowledge derived from well-studied, epidemiologically relevant Salmonella serovars, yet many less frequent types still pose a risk to consumers and may contaminate fresh produce. Different Salmonella serovars may vary in the relative contribution of persistence mechanisms. Recognizing these differences is essential for improving precision food safety efforts, particularly for foods such as sprouts that are repeatedly linked to outbreaks. This study highlights that less-studied serovars can rely on both shared survival strategies and unique traits that might otherwise not be captured by current control approaches. By demonstrating that strain diversity influences persistence on fresh produce, this work supports the development of precision food safety strategies that address a broader spectrum of Salmonella, thereby improving risk assessment and helping to better protect public health.

food safety↗

PubMed1978

Studies on bacteroid size and nucleic acid content of alfalfa bacteroids fractionated by velocity sedimentation.

A velocity sedimentation procedure was described to fractionate bacteroids of alfalfa nodules into four subpopulations. Bacteroids in these subpopulations were different in size and nucleic acid content as determined by microscopy and flow-microfluorometry (FMF). The slowest-sedimenting bacteroids (fraction I) were small and resembled free-living Rhizobium meliloti both in size and nucleic acid content. The fastest-sedimenting bacteroids (fraction IV) were 2 to 3 times longer and contained 3 to 4 times more nucleic acid than the small bacteroids in fraction I and free-living R. meliloti. A positive correlation was established between bacteroid size and relative nucleic acid content of bacteroids in alfalfa nodules.

Medicago sativa↗

PubMed1979

[Changes in DNA methylation in alfalfa plants infected with Cuscuta and tissue differences in DNA methylation of the parasite plants].

The tissue-specific differences in the 5-methylcytosine (m5C) content in total DNA of the parasite plant Cuscuta reflexa have been found: DNA from apical parts of the plant is less methylated (m5C = 4,2 mol %) as compared to the DNA from haustoria and posthaustorial regions (m5C = 5,4 mol %). The base compositions of total DNA preparations from C. reflexa grown on various hosts are similar. The m5C amount in stem DNA of the alfalfa plant infected with C. reflexa is by approximately 25% higher than that in the non-infected plant DNA. The GC content in alfalfa DNA does not change as a result of infection. Thus, the parasite induces the hypermethylation of DNA in the host plant. It is assumed that the changes in DNA methylation induced by the parasite plant may play a regulatory role and may cause changes in transcription and replication of host DNA.

Cytosine↗

PubMed1976

RNA-protein interactions in alfalfa mosaic virus.

Particles of the bottom component of alfalfa mosaic virus have a compact bacilliform structure at neutral pH. When the pH is raised to 8.3 the structure unfolds. Since the particle weight does not change it is concluded that the protein subunits remain attached to the RNA. The particle weight of the spheroidal top component a of the virus is halved when the particles unfold at pH 8.3. This can be explained by the fact that these particles contain two RNA molecules of identical size. Free RNA molecules of alfalfa mosaic virus are able to withdraw protein subunits from intact particles of the virus. It is demonstrated that per RNA molecule there are a few sites with a high affinity for coat protein. Possibly these are the sites where the coat protein plays its role in activating the genome.

Genetics↗

PubMed1978

Influence of a few coat protein subunits on the base-paired structure of the RNA species of alfalfa mosaic virus.

Differentiated thermal melting profiles were made of all the three RNA species (RNAs 1, 2 and 3), constituting the genome of alfalfa mosaic virus and of the subgenomic coat protein messenger RNA (RNA 4) of this virus. Whereas all profiles showed multiphasicity the profile of RNA 4 was most clearly subdivided showing three clear transitions with tm values of 25.5, 35.5 and 53 degrees C. The first transition disappeared upon addition of 6 coat protein molecules per molecule of RNA 4. The effect of coat protein on the melting profiles of the genome RNAs was much less clear.

Capsid↗

PubMed1979

Influence of a few coat protein subunits on the base-paired structure of 3'-terminal fragments of RNA 4 of alfalfa mosaic virus.

In contrast to expectation (Srinivasan, S. and Jaspars, E.M.J. (1978) Biochim. Biophys. Acta 520, 237-241) differentiated thermal melting profiles and fluorescence measurements show that the coat protein of alfalfa mosaic virus has a negligible effect on the base-paired structure of isolated 3'-terminal fragments (length about 90 nucleotides) of the coat protein messenger RNA (RNA 4) of this virus.

Ethidium↗

PubMed1978

Influence of soil pH and calcium nutrition on resistance of alfalfa to bacterial and verticillium wilt.

Alfalfa plants of a resistant, a susceptible and a highly susceptible strains were grown in unlimed soil at pH 5.8 and in limed one at pH 6.9 and inoculated by the pathogens of vascular wilt, Corynebacterium insidiosum and Verticillium albo-atrum. Two types of liming were performed: 1) before inoculation and 2) after inoculation. Liming of the soil led to an increase in number of resistant plants. In susceptible plants the external symptoms of disease on the plant tops were delayed or alleviated. This phenomen was more conspicuous with Verticillium wilt than with bacterial wilt. The favourable effect of liming was less distinct in resistant strains than in susceptible ones. For an increase in resistance, post-infection liming of the soil was more effective in the case of bacterial wilt, while pre-infection liming provided the best results in the Verticillium wilt. The nitrogen content in the dry matter of roots from plants grown in limed soil was higher by more than a quarter as compared to roots from plants growing in unlimed soil.

Calcium↗

PubMed1977

Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.

Base Sequence↗