PubMed HealthSearch

SEARCH · PubMed Health

Results for “Chalcone”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

Comparative studies on the antirhinovirus activity and the mode of action of the rhinovirus capsid binding agents, chalcone amides.

Studies of various analogs related to the antirhinovirus agent 4'-ethoxy-2'-hydroxy-4,6'-dimethoxychalcone (Chalcone Ro 09-0410) led to the identification of amide analogs that are 4.5 to 10 times more active against human rhinovirus (HRV) in tissue culture as measured by chemotherapeutic indices. Chalcone amides Ro 09-0535, Ro 09-0696 and Ro 09-0881 inhibited viral replication at concentrations as low as less than 2-3 ng/ml and were cytotoxic between 30 to 50 micrograms/ml. These compounds bind to HRV and reduce the virus infectivity titers by 3 log10 or greater at 0.5 micrograms/ml for 60 min similar to Ro 09-0410. These amide analogs competitively inhibited the binding of [3H]Ro 09-0410 to the viral capsid similar to capsid binding antirhinovirus agents, Ro 09-0410, 4',6-dichloroflavan and WIN-51711. Furthermore, strains of HRV type 2 resistant to each of the above agents showed cross-resistance to all other agents. These results indicate that the chalcone amides also bind to the same or close-proximity site for the capsid binding antirhinovirus agents, which is on the specific site within the viral capsid protein. However, differences in the degree of the inhibition of [3H]Ro 09-0410 binding, cross-resistance of strains of HRV resistant to the agents and HRV serotype specificity were observed not only between the chalcone amides and the other antivirus agents (Ro 09-0410, 4',6-dichloroflavan and WIN-51711) but also among the chalcone amides, particularly between Ro 09-0535 and Ro 09-0696. These differences are presumably due to alterations in the binding affinities of compounds as a consequence of variations in the shape and size of the hydrophobic pocket that exists between serotypes including resistant strains.

Amides

Stilbene and chalcone synthases: related enzymes with key functions in plant-specific pathways.

Several years of extensive research using the new powerful techniques of molecular biology have enabled the direct comparison of functionally or evolutionarily related genes and their products at the nucleotide and amino acid sequence levels. Two types of synthase with similar functions are discussed as an interesting example. Stilbene synthases, e.g. resveratrol synthase, produce the stilbene backbone as a key reaction in the biosynthesis of stilbene-type phytoalexins. Chalcone synthase is a key enzyme in the biosynthesis of flavonoids, including certain phytoalexins derived from a 6'-deoxychalcone which is synthesized by cooperation of chalcone synthase with a reductase. Resveratrol and chalcone synthases utilize the same substrates (4-coumaroyl-CoA and 3 molecules of malonyl-CoA) and catalyze the same condensing type of enzyme reaction (resulting in sequential addition of acetate units via malonyl-CoA), but the products differ in the newly formed ring systems (resveratrol and naringenin chalcone). A comparative analysis of cloned DNA sequences and of the reaction mechanisms indicates that the two enzymes are closely related. It seems likely that the proteins possess a common scaffold for substrate recognition and for the condensing reaction, and that the different folding of an enzyme-bound intermediate prior to closure of the new aromatic ring is responsible for the formation of the different products. The same type of condensing reaction is utilized by the 2-ketoacyl-ACP synthases of fatty-acid biosynthesis. However, the available data indicate that these enzymes share little overall homology with either resveratrol or chalcone synthase. One exception may be a short amino acid sequence which corresponds to the active center of the condensing reaction in 2-ketoacyl-ACP synthases.

Acyltransferases

Chalcone-indole hybrid scaffolds as promising anticancer drug candidates: a mini-review.

Cancer treatment is hampered by severe systemic side effects, poor tumor selectivity, and multidrug resistance (MDR). Molecular hybridization integrates chalcone and indole, two privileged antitumor pharmacophores, into one scaffold to generate chalcone-indole hybrids that synergistically enhance antitumor potency, improve tumor targeting, and reverse MDR. This mini-review analyzes literature from 2020 to 2026 on chalcone-indole anticancer hybrids. Based on structural modification patterns, the reported hybrids are categorized into four subgroups: simple substituted, α/β-position modified, N-1 fatty acid-substituted, and multi-pharmacophore fused hybrids. For each category, we summarize structure-activity relationships (SARs), antiproliferative activity, selective toxicity, molecular mechanisms, and in vivo xenograft performance. Most lead compounds exert tumor-suppressive effects via tubulin polymerization inhibition, G2/M cell cycle arrest, ROS overaccumulation, and mitochondrial-dependent apoptosis. Representative hybrids 10a, 12a, 21a, and 25a exhibit remarkable efficacy against drug-resistant colorectal, lung, and breast tumors with favorable in vivo safety. We highlight the application potential of different subtypes for specific malignancies, including α/β-modified analogues for resistant colorectal cancer, N-1 fatty acid-platinum conjugates for platinum-resistant lung cancer, NLRP3 inhibitor 7a for oral cancer, and multi-pharmacophore fused derivatives for broad-spectrum activity. Current bottlenecks limiting clinical transformation are discussed. This review provides structural design rules for developing novel chalcone-indole targeted anticancer agents.

Humans

Carnation I locus contains two chalcone isomerase genes involved in orange flower coloration.

Carnations carrying a recessive I gene show accumulation of the yellow pigment chalcononaringenin 2'-glucoside (Ch2'G) in their flowers, whereas those with a dominant I gene do accumulation the red pigment, anthocyanin. Although this metabolic alternative at the I gene could explain yellow and red flower phenotypes, it does not explain the development of orange flower phenotypes which result from the simultaneous accumulation of both Ch2'G and anthocyanin. The carnation whole genome sequencing project recently revealed that two chalcone isomerase genes are present, one that is consistent with the I gene (Dca60979) and another (Dca60978) that had not been characterized. Here, we demonstrate that Dca60979 shows a high level of gene expression and strong enzyme activity in plants with a red flower phenotype; however, functional Dca60979 transcripts are not detected in plants with an orange flower phenotype because of a dTdic1 insertion event. Dca60978 was expressed at a low level and showed a low level of enzyme activity in plants, which could catalyze a part of chalcone to naringenin to advance anthocyanin synthesis but the other part remained to be catalyzed chalcone to Ch2'G by chalcone 2'-glucosyltransferase, resulting in accumulation of anthocyanin and Ch2'G simultaneously to give orange color.

I gene

Reactions of hydroxybenzofurans. VI. Syntheses of benzofuran chalcones, hydrazones and pyrazolines of potential biological activity.

Condensation of 5-acetyl-6-methoxy- (I) and 6-acetyl-5-methoxy-2,3-diphenylbenzofuran (II) with aromatic aldehydes gave the chalcones IIIa--f and IVa--f, respectively. Reaction of the chalcones IIIa--f and IVa--f with hydrazine hydrate-acetic acid mixture yielded the corresponding N-acetyl pyrazolines Va--f and VIa--f. The chalcones IIIa--f and IVa--f reacted with phenylhydrazine in ethanol to yield the corresponding phenylhydrazones VIIa--f and VIIIa--f. The latter hydrazones cyclize easily with boiling glacial acetic acid to the corresponding pyrazoline derivatives (IXa--f and Xa--f). The antibacterial activity of the chalcones and pyrazolines was investigated.

Bacteria

Molecular analysis of chalcone and dihydropinosylvin synthase from Scots pine (Pinus sylvestris), and differential regulation of these and related enzyme activities in stressed plants.

Chalcone synthase (CHS) and stilbene synthase (STS) are closely related polyketide synthases which are key enzymes in the biosynthesis of flavonoids and stilbenes. Scots pine (Pinus sylvestris) is an interesting plant for a direct comparison of the enzymes. It not only contains the usual flavonoids, but also an unusual chalcone derivative (pinocembrin), and it synthesizes stilbenes of the pinosylvin type. We analysed a CHS and a STS by molecular cloning and functional expression in Escherichia coli. The CHS was active not only with 4-coumaroyl-CoA (to naringenin chalcone), but also with cinnamoyl-CoA (leading to pinocembrin). The STS was identified as dihydropinosylvin synthase, because it preferred dihydrocinnamoyl-CoA to cinnamoyl-CoA. The protein deviated in 47 positions from the CHS consensus. It had 73.2% identity with the CHS from P. sylvestris and only 65.3% with a STS from peanut (Arachis hypogaea). We also investigated the regulation of both enzyme types in P. sylvestris plantlets exposed to stress. CHS was present in non-stressed plantlets, and induction led to a transient increase with a peak after 16 h. STS type activities were regulated differently and were absent in non-stressed plantlets. Increases were observed after a lag period of at least 6 h, and highest activities were obtained after 30 h. The analysis of the reactions in the plant extracts and the substrate specificity of the cloned STS indicate that the plants contain at least two different types of STS: the cloned dihydropinosylvin synthase and a pinosylvin synthase which preferentially utilizes cinnamoyl-CoA as substrate.

Acyltransferases

Introduction of unnatural amino acids into chalcone isomerase.

The active site cysteine residue of chalcone isomerase was rapidly and selectively modified under denaturing conditions with a variety of electrophilic reagents. These denatured and modified enzyme were renatured to produce enzyme derivatives containing a series of unnatural amino acids in the active site. Addition of methyl, ethyl, butyl, heptyl, and benzyl groups to the cysteine sulfur does not abolish catalytic activity, although the activity decreases as the steric bulk of the amino acid side-chain increases. Modification of the cysteine to introduce a charged homoglutamate or a neutral homoglutamine analogue results in retention of 22% of the catalytic activity. Addition of a methylthio group (SMe) to the cysteine residue of native chalcone isomerase preserves 85% of the catalytic activity measured with 2',4',4-trihydroxychalcone, 2',4',6',4-tetrahydroxychalcone, or 2'-hydroxy-4-methoxychalcone as substrates. The competitive inhibition constant for 4',4-dihydroxychalcone, the substrate inhibition constant for 2',4',4-trihydroxychalcone, and other steady-state kinetic parameters for the methanethiolated enzyme are very similar to those of the native enzyme. The strong binding of 4',4-dihydroxychalcone to the methanethiolated enzyme shows that there is no steric repulsion between this modified amino acid residue and the substrate analogue. This structure-activity study clearly demonstrates that the active site cysteine residue does not function as an acid-base or nucleophilic group in producing the catalysis or substrate inhibition observed with chalcone isomerase. The method presented in this paper allows for the rapid introduction of a series of unnatural amino acids into the active site as a means of probing the structure-function relationship.

Alkylation

Inhibition of ocular inflammation by chalcone derivatives and prednisolone.

Posterior uveitis was induced by injection of 10 micrograms endotoxin intravitreally into rat eyes and anterior ocular inflammation was induced by injection of 0.75 mg of lens protein intracamerally into rabbit eyes. Four chalcone derivatives, RVC-556 (2'-hydroxychalcone), RVC-574 (2'-hydroxychalcone hydrazone), RVC-574P (2'-hydroxychalcone phenyl hydrazone) and RVC-588 (4,4'-dihydroxy chalcone) were studied along with prednisolone at a dose of 10 mg/kg i.p. t.i.d. for their anti-inflammatory actions. RVC-574 was more active than prednisolone in inhibiting posterior uveitis by 65% and 43%, respectively. RVC-556, RVC-574P, and RVC-588 did not affect the posterior uveitis in rats. On the other hand, anterior ocular inflammation was inhibited by 1% eyedrops of RVC-556, RVC-574P and RVC-588 but not by RVC-574. RVC-556 was more active than; RVC-574P was less active than; and RVC-588 was about equiactive as prednisolone in inhibiting anterior ocular inflammation by 77%, 47%, 69%, and 64%, respectively.

Animals

Antibacterial activity of two chalcones, xanthoangelol and 4-hydroxyderricin, isolated from the root of Angelica keiskei KOIDZUMI.

Two chalcones, xanthoangelol (I) and 4-hydroxyderricin (II), isolated from the root of Angelica keiskei KOIDZUMI (Umbelliferae) showed antibacterial activity against gram-positive pathogenic bacteria. The activity of I on Micrococcus luteus IFO-12708 (minimum inhibitory concentration (MIC), 0.76 microgram/ml) was the same potency as that of gentamicin, which is used as a standard. Although the activity of both chalcones on plant-pathogenic bacteria was lower than that of streptomycin sulfate, used as a positive control, they also exhibited growth-inhibitory effects. The antibacterial activity of I isolated from Angelica keiskei KOIDZUMI is being reported here for the first time. The growth-inhibitory effect of II on plant-pathogenic bacteria is also reported for the first time in this paper.

Anti-Bacterial Agents

The duplicated chalcone synthase genes C2 and Whp (white pollen) of Zea mays are independently regulated; evidence for translational control of Whp expression by the anthocyanin intensifying gene in.

Two chalcone synthase genes in maize have been cloned and molecularly characterized to be the C2 and the Whp (white pollen) locus. The two genes have highly homologous exon sequences but differ considerably in sequences 5' upstream and 3' downstream of the coding region, as well as in their introns. Northern and Western experiments of chalcone synthase expression in various tissues and in different genotypes indicated that C2 and Whp are differently regulated. The expression of Whp in maize aleurone is dependent on the presence of the recessive allele of the gene intensifier (in). The regulatory effect of in on Whp expression is not detectable at the transcriptional level, but seems to take place during translation.

Acyltransferases

Purification of tobacco nuclear proteins binding to a CACGTG motif of the chalcone synthase promoter by DNA affinity chromatography.

The activity of various light-regulated and developmentally regulated plant gene promoters critically depends upon the presence of a conserved sequence with a central CACGTG motif. Using band-shift assays, we have identified nuclear factor(s) from Nicotiana tabacum, termed CG-1, that specifically recognize(s) this transcriptional element in the ultraviolet-light-regulated Antirrhinum majus chalcone synthase promoter. CG-1 activity is constitutively expressed in tobacco seedlings grown in the absence of ultraviolet light as well as in seedlings induced for chalcone synthase gene expression by ultraviolet light irradiation. CG-1 activity has also been detected in flower tissue. DNA-protein cross-linking studies identified three polypeptides with apparent molecular masses of 20, 32 and 42 kDa binding to the CACGTG motif. Proteins interacting with the CACGTG motif were purified from N. tabacum seedlings using differential sequence-specific DNA affinity chromatography employing wild-type and mutated CG-1-binding sites. Denaturing polyacrylamide gel electrophoresis revealed major polypeptides of approximately 20, 30 and 40 kDa which are highly enriched in the affinity-purified fractions binding specifically to the CACGTG motif.

Acyltransferases

[Molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction].

Using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to C-terminal peptides GGAACTCCCTTTTCTGGATAGCTCACC and CCTGGTCCGAACCCAAACAGGACGCCCC, were used to amplify, via polymerase chain reaction, genomic sequences from two Gossypium species, a diploid Gossypium herbaceum, and a tetraploid Gossypium hirsutum cv. 108F. Amplified DNA was separated into individual sequences by cloning into an M13 vector. Six different sequences were identified in each species. From each set of six, one sequence was found to be identical to the genomic sequence, which we have isolated from a subgenomic library of 108F DNA in lambda NM1149. Comparison of other sequences has allowed to find another pair of identical sequences, as well as to get an evidence, that the set isolated from the tetraploid cotton contained preferentially members of only one of the two subfamilies, probably due to primer specificity in amplification reaction. Comparison of specific amino acid substitutions in homologous sequences of cotton, peanut and soybean also suggested that all of the sequences isolated from cotton are more likely to code for chalcone synthase, that for a similar enzyme resveratrol synthetase.

Acyltransferases

The role of cysteines in polyketide synthases. Site-directed mutagenesis of resveratrol and chalcone synthases, two key enzymes in different plant-specific pathways.

Resveratrol and chalcone synthases are related plant-specific polyketide synthases that are key enzymes in the biosynthesis of stilbenes and flavonoids, respectively. The stepwise condensing reactions correspond to those in other polyketide and fatty-acid synthases. This predicts that the two proteins also contain cysteines that are essential for enzyme activity because they bind the substrates. We exchanged, in both enzymes, all of the 6 conserved cysteines into alanine by site-directed mutagenesis and tested the mutants after expression of the proteins in the Escherichia coli heterologous system. Only cysteine 169 was essential in both enzymes, and inhibitor studies suggest that it is the main target of cerulenin, an antibiotic reacting with the cysteine in the active center of condensing enzymes. Most of the other exchanges led to reduced activities. In two cases, the enzymes responded differently, suggesting that the cysteines at positions 135 and 195 may be involved in the different product specificity of the two enzymes. The sequences surrounding the essential cysteine 169 revealed no similarity to the active sites of condensing enzymes in other polyketide synthases and in fatty acid biosynthesis. The available data indicate that resveratrol and chalcone synthases represent a group of enzymes that evolved independently of other condensing enzymes.

Acyltransferases

Pathogenicity for humans of human rhinovirus type 2 mutants resistant to or dependent on chalcone Ro 09-0410.

Mutants of human rhinovirus type 2 (HRV-2) resistant to and dependent on the antirhinoviral compound chalcone Ro 09-0410 were selected in cell culture under clean laboratory conditions. A total of 42 volunteers were challenged with either the drug-resistant mutant [SR2-410(r)] (15 volunteers), the drug-dependent mutant [SR2-410(d)] (15 volunteers), or a wild-type HRV-2 which had a similar passage level in vitro as the mutants but without the drug (12 volunteers). Of volunteers challenged with the wild-type HRV-2, 33, 67, and 82% developed cold symptoms, shed virus, and showed serological evidence of infection, respectively. In contrast, only 13, 27, and 23% of volunteers challenged with the drug-resistant mutant developed colds, shed virus, and showed serological evidence of infection, respectively. None of the volunteers challenged with the drug-dependent virus became infected or had symptoms of colds. These results demonstrate that a drug-resistant rhinovirus was capable of infecting humans and producing disease, although its infectivity was reduced when compared with that of the wild type. In contrast, a drug-dependent virus had lost its ability to infect humans.

Adolescent

Chalcone tetramers, lophirachalcone and alatachalcone, from Lophira alata as possible anti-tumor promoters.

Two chalcone tetramers were isolated as inhibitors of Epstein-Barr virus (EBV)-activation induced by a tumor promoter, teleocidin B-4, from a medicinal plant in tropical west Africa, Lophira alata (Ochnaceae). One of them was identified as lophirachalcone. The other, named alatachalcone, was new, and the structure was determined by spectral properties. Both compounds also showed potent inhibitory activities against teleocidin B-4-induced inflammation on mouse ear. In an initiation-promotion experiment on mouse skin, alatachalcone (16 nmol) significantly inhibited tumor promotion caused by 12-O-tetradecanoylphorbol-13-acetate (TPA, 1.6 nmol).

9,10-Dimethyl-1,2-benzanthracene

Inoculation of Vicia sativa subsp. nigra roots with Rhizobium leguminosarum biovar viciae results in release of nod gene activating flavanones and chalcones.

Flavonoids released by roots of Vicia sativa subsp. nigra (V. sativa) activate nodulation genes of the homologous bacterium Rhizobium leguminosarum biovar viciae (R. l. viciae). Inoculation of V. sativa roots with infective R. l. viciae bacteria largely increases the nod gene-inducing ability of V. sativa root exudate (A.A.N. van Brussel et al., J Bact 172: 5394-5401). The present study showed that, in contrast to sterile roots and roots inoculated with R. l. viciae cured of its Sym plasmid, roots inoculated with R. l. viciae harboring its Sym plasmid released additional nod gene-inducing flavonoids. Using 1H-NMR, the structures of the major inducers released by inoculated roots, 6 flavanones and 2 chalcones, were elucidated. Roots extracts of (un)inoculated V. sativa contain 4 major non-inducing, most likely glycosylated, flavonoids. Therefore, the released flavonoids may either derive from the root flavonoids or inoculation with R. l. viciae activates de novo flavonoid biosynthesis.

Chalcone

Pangenome-wide identification and expression analysis of the chalcone synthase (CHS) gene family in five yellowhorn spp.

Chalcone synthase (CHS) is a pivotal enzyme in flavonoid biosynthesis involved in plant development, defense, and secondary metabolism. Xanthoceras sorbifolium (yellowhorn) is a medicinal and ornamental species with high resistance to environmental stresses, but its CHS gene family remains uncharacterized. We performed a pangenome-wide identification of CHS genes across five yellowhorn genomes (Xzs4, Xwf8, Xjg, Xg11, and Xzg2). Across the five yellowhorn genomes, 27 CHS genes were identified and classified into four core pangenes, present in all five genomes, and two dispensable genes, present only in a subset of genomes. Phylogenetic analysis grouped these genes into three major clades, and chromosomal mapping and duplication analyses identified four tandemly duplicated gene pairs under purifying selection. The analyses of conserved structural features, including protein motifs and exon-intron organization, together with promoter cis-regulatory elements and gene ontology annotation, further indicated the potential involvement of CHS genes in flavonoid biosynthesis and stress-responsive mechanisms. Gene expression profiling identified significant upregulation of Xg11_CHS1 and Xg11_CHS3 under cold and drought stress, with tissue-specific expression patterns. These findings provide valuable insights into the evolution, functional diversification, and stress-responsive roles of the CHS gene family, identifying candidate genes for future studies targeting stress tolerance and flavonoid biosynthesis in yellowhorn.

Acyltransferases