Carboxylic acid and sulfonic acid derivatives of chalcone and chalcone epoxide [(author's transl)].
Explore the source record for details and available documents.
SEARCH · PubMed Health
Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Explore the source record for details and available documents.
Cancer treatment is hampered by severe systemic side effects, poor tumor selectivity, and multidrug resistance (MDR). Molecular hybridization integrates chalcone and indole, two privileged antitumor pharmacophores, into one scaffold to generate chalcone-indole hybrids that synergistically enhance antitumor potency, improve tumor targeting, and reverse MDR. This mini-review analyzes literature from 2020 to 2026 on chalcone-indole anticancer hybrids. Based on structural modification patterns, the reported hybrids are categorized into four subgroups: simple substituted, α/β-position modified, N-1 fatty acid-substituted, and multi-pharmacophore fused hybrids. For each category, we summarize structure-activity relationships (SARs), antiproliferative activity, selective toxicity, molecular mechanisms, and in vivo xenograft performance. Most lead compounds exert tumor-suppressive effects via tubulin polymerization inhibition, G2/M cell cycle arrest, ROS overaccumulation, and mitochondrial-dependent apoptosis. Representative hybrids 10a, 12a, 21a, and 25a exhibit remarkable efficacy against drug-resistant colorectal, lung, and breast tumors with favorable in vivo safety. We highlight the application potential of different subtypes for specific malignancies, including α/β-modified analogues for resistant colorectal cancer, N-1 fatty acid-platinum conjugates for platinum-resistant lung cancer, NLRP3 inhibitor 7a for oral cancer, and multi-pharmacophore fused derivatives for broad-spectrum activity. Current bottlenecks limiting clinical transformation are discussed. This review provides structural design rules for developing novel chalcone-indole targeted anticancer agents.
Carnations carrying a recessive I gene show accumulation of the yellow pigment chalcononaringenin 2'-glucoside (Ch2'G) in their flowers, whereas those with a dominant I gene do accumulation the red pigment, anthocyanin. Although this metabolic alternative at the I gene could explain yellow and red flower phenotypes, it does not explain the development of orange flower phenotypes which result from the simultaneous accumulation of both Ch2'G and anthocyanin. The carnation whole genome sequencing project recently revealed that two chalcone isomerase genes are present, one that is consistent with the I gene (Dca60979) and another (Dca60978) that had not been characterized. Here, we demonstrate that Dca60979 shows a high level of gene expression and strong enzyme activity in plants with a red flower phenotype; however, functional Dca60979 transcripts are not detected in plants with an orange flower phenotype because of a dTdic1 insertion event. Dca60978 was expressed at a low level and showed a low level of enzyme activity in plants, which could catalyze a part of chalcone to naringenin to advance anthocyanin synthesis but the other part remained to be catalyzed chalcone to Ch2'G by chalcone 2'-glucosyltransferase, resulting in accumulation of anthocyanin and Ch2'G simultaneously to give orange color.
Condensation of 5-acetyl-6-methoxy- (I) and 6-acetyl-5-methoxy-2,3-diphenylbenzofuran (II) with aromatic aldehydes gave the chalcones IIIa--f and IVa--f, respectively. Reaction of the chalcones IIIa--f and IVa--f with hydrazine hydrate-acetic acid mixture yielded the corresponding N-acetyl pyrazolines Va--f and VIa--f. The chalcones IIIa--f and IVa--f reacted with phenylhydrazine in ethanol to yield the corresponding phenylhydrazones VIIa--f and VIIIa--f. The latter hydrazones cyclize easily with boiling glacial acetic acid to the corresponding pyrazoline derivatives (IXa--f and Xa--f). The antibacterial activity of the chalcones and pyrazolines was investigated.
Using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to C-terminal peptides GGAACTCCCTTTTCTGGATAGCTCACC and CCTGGTCCGAACCCAAACAGGACGCCCC, were used to amplify, via polymerase chain reaction, genomic sequences from two Gossypium species, a diploid Gossypium herbaceum, and a tetraploid Gossypium hirsutum cv. 108F. Amplified DNA was separated into individual sequences by cloning into an M13 vector. Six different sequences were identified in each species. From each set of six, one sequence was found to be identical to the genomic sequence, which we have isolated from a subgenomic library of 108F DNA in lambda NM1149. Comparison of other sequences has allowed to find another pair of identical sequences, as well as to get an evidence, that the set isolated from the tetraploid cotton contained preferentially members of only one of the two subfamilies, probably due to primer specificity in amplification reaction. Comparison of specific amino acid substitutions in homologous sequences of cotton, peanut and soybean also suggested that all of the sequences isolated from cotton are more likely to code for chalcone synthase, that for a similar enzyme resveratrol synthetase.
Two chalcone tetramers were isolated as inhibitors of Epstein-Barr virus (EBV)-activation induced by a tumor promoter, teleocidin B-4, from a medicinal plant in tropical west Africa, Lophira alata (Ochnaceae). One of them was identified as lophirachalcone. The other, named alatachalcone, was new, and the structure was determined by spectral properties. Both compounds also showed potent inhibitory activities against teleocidin B-4-induced inflammation on mouse ear. In an initiation-promotion experiment on mouse skin, alatachalcone (16 nmol) significantly inhibited tumor promotion caused by 12-O-tetradecanoylphorbol-13-acetate (TPA, 1.6 nmol).
Chalcone synthase (CHS) is a pivotal enzyme in flavonoid biosynthesis involved in plant development, defense, and secondary metabolism. Xanthoceras sorbifolium (yellowhorn) is a medicinal and ornamental species with high resistance to environmental stresses, but its CHS gene family remains uncharacterized. We performed a pangenome-wide identification of CHS genes across five yellowhorn genomes (Xzs4, Xwf8, Xjg, Xg11, and Xzg2). Across the five yellowhorn genomes, 27 CHS genes were identified and classified into four core pangenes, present in all five genomes, and two dispensable genes, present only in a subset of genomes. Phylogenetic analysis grouped these genes into three major clades, and chromosomal mapping and duplication analyses identified four tandemly duplicated gene pairs under purifying selection. The analyses of conserved structural features, including protein motifs and exon-intron organization, together with promoter cis-regulatory elements and gene ontology annotation, further indicated the potential involvement of CHS genes in flavonoid biosynthesis and stress-responsive mechanisms. Gene expression profiling identified significant upregulation of Xg11_CHS1 and Xg11_CHS3 under cold and drought stress, with tissue-specific expression patterns. These findings provide valuable insights into the evolution, functional diversification, and stress-responsive roles of the CHS gene family, identifying candidate genes for future studies targeting stress tolerance and flavonoid biosynthesis in yellowhorn.
Michael-type adducts, 1,3-heterocyclic-3-mercaptopropan-1-ones, were prepared by the base-catalyzed reaction of heterocyclic chalcones with thiols. These new compounds were found to be active as fungicides.
The isolation of eight prenylated chalcones (cordoin, isocordoin, psi-isocordoin, derricin, lonchocarpin, 4-hydroxyderricin, 4-hydroxylonchocarpin, 4-hydroxyisocordoin) and of the flavanone and dihydrochalcone corresponding to cordoin is described. These substances are biogenetically correlated. The structures of the above mentioned substances were established through the examination and comparison of spectral data (U.V., I.R., N.M.R., M.S.) and of the chemical behaviour. Particular interest is shown by psi-isocordoin and 4-hydroxy derivatives. The latter and 4-hydroxyderricin in particular show also a marked inhibition on the growth of gram-positive bacteria.
A number of synthetic analogs of the prenylated and chromene chalcones isolated from lonchocarpus neuroscapha (Leguminosae) were obtained by condensation of prenylated acetophenones with substituted benzaldehydes. The antibacterial activity of these products was studied and correlated with their structure.
The phenylpropanoid pathway intermediate p-coumaric acid (4-CA) stimulates expression of the bean (Phaseolus vulgaris L.) chalcone synthase (malonyl-CoA:4-coumaroyl-CoA, EC 2.3.1.74) chs15 gene promoter in electroporated protoplasts of alfalfa (Medicago sativa L.). We have analyzed the effects of 5' deletions, mutations, and competition with promoter sequences in trans on the expression of a chs15 promoter-chloramphenicol acetyltransferase gene fusion in elicited alfalfa protoplasts. Two distinct sequence elements, the H-box (consensus CCTACC(N)7CT) and the G-box (CACGTG), are required for stimulation of the chs15 promoter by 4-CA. Furthermore, a 38-base-pair chs15 promoter sequence containing both cis elements conferred responsiveness to 4-CA on the cauliflower mosaic virus 35S minimal promoter. The H-box and G-box in combination establish the complex developmental pattern of chs15 expression and are also involved in stress induction. Hence, potential internal pathway regulation through feed-forward stimulation by 4-CA operates by modulation of the signal pathways for developmental and environmental regulation.
Analysis of the expression of the GUS reporter gene driven by various regions of the Petunia hybrida chalcone synthase (chsA) promoter revealed that the developmental and organ-specific expression of the chsA gene is conferred by a TATA proximal module located between -67 and -53, previously designated as the TACPyAT repeats. Histochemical analysis of GUS reporter gene expression revealed that the organ-specific 67 bp promoter fragment directs the same cell-type specificity as a 530 bp promoter, whereas additional enhancer sequences are present within the more TATA distal region. Moreover, the region between -800 and -530 is also involved in extending the cell-type specificity to the trichomes of flower organs and of young seedlings. The mechanism by which the TACPyAT repeats modulate expression during plant development was studied by analysing the expression of the GUS gene driven by chimeric promoters consisting of the CaMV 35S enhancer (domain B, -750 to -90) fused to various chsA 5' upstream sequences. Detailed enzymatic and histochemical analysis revealed that in the presence of the TACPyAT module the CaMV 35S region only enhances GUS activity in those organs in which the chsA promoter is normally active. Furthermore, this analysis shows that enhancement in the presence of the CaMV 35S domain B is accomplished by increasing the number of cell types expressing the GUS gene within the organ, rather than enhancement of the chsA cell-type-specific expression within these organs. Deletion of the TACPyAT sequences in the chimeric promoter construct completely restores the well-documented CaMV 35S domain B cell-type specificity, showing that the TACPyAT module acts as a dominant negative cis-acting element which controls both organ and developmental regulation of the chsA promoter activity.
The chalcone-flavanone isomerase from soya bean seed has been purified 8300-fold. A molecular weight of 15,600 plus or minus 1000 has been determined for the enzyme. Effects of iodoacetamide and sodium tetrathionate on the enzyme, and pH dependence of the catalytic step, indicate that a sulphydryl group is not involved in the reaction mechanism and the catalytic group is probably an imidazole side chain in the basic form. The kinetics of the isomerisation of isoliquiritigenin to liquiritigenin have been examined and show that at pH 7.6 the reaction is reversible with an equilibrium constant of 37 in favour of flavanone. A number of flavonoid compounds competitively inhibit the reaction, suggesting a possible regulatory role for this enzyme in flavonoid biosynthesis.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
A series of extracted fractions from sophora subprostrata was screened by determining anti-ulcer effects in pylorus ligated and stressed rats. Fr. [C-2] had the most potent anti-ulcer effects of all fractions extracted. Sophoradin and sophoranone which were isolated from Fr. [C-2] were also found to have inhibitory effects on ulcer formation in pylorus ligated and stressed rats. The anti-ulcer effect of sophoradin was relatively potent in comparison with that of sophoranone and/or Fr. [C-2]. The anti-ulcer effect of sophoranone was approximately the same as that of Fr. [C-2]. The authors examined the effects of sophoradin and sophoranone on gastric secretion in pylorus ligated rats. Sophoradin and sophoranone significantly reduced the volume of gastric juice. Sophoradin but not sophoranone inhibited the free and total acid output of gastric juice. The effect of sophoradin was examined on various secretagogues which induced gastric secretions in rats with acute fistula. Sophoradin showed a tendency to inhibit tetragastrin- and insulin-induced gastric acid secretion, but there were no effects on methacholine- and histamine-induced secretions. These results suggest that sophoradin may have marked anti-ulcer and inhibitory effects on gastric secretion.
Explore the source record for details and available documents.