PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Codon, Initiator”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources
PubMed2026

A-to-I RNA editing remodels 5'-UTR initiation codons to tune translational output.

A-to-I RNA editing is a prevalent post-transcriptional modification in higher eukaryotes that converts adenosine to inosine within RNA molecules. Because inosine is interpreted as guanosine during translation, editing can alter codon identity and potentially influence translation initiation signals. Here, we examined whether A-to-I editing within the 5' untranslated region (5'-UTR) can remodel upstream initiation codons and thereby tune downstream translation. Using luciferase-based reporter systems, we show that AUA-to-AUI editing generates an initiation-competent inosine-containing codon, whereas AUG-to-IUG editing markedly attenuates initiation and can relieve uORF-mediated repression. Quantitative in vitro and cellular assays establish the initiation hierarchy AUA&#x2009;<&#x2009;AUI&#x2009;<&#x2009;AUG, with IUG exhibiting strongly reduced initiation efficiency. Importantly, AUI-mediated upstream initiation did not behave like a canonical AUG-initiated uORF in the tested contexts; its effect on downstream ORF translation was modest and context-dependent. Transcriptome-wide bioinformatic analysis identified endogenous human transcripts whose 5'-UTRs harbor editing sites compatible with initiation-codon gain or attenuation. Reporter validation using native 5'-UTR sequences supports the possibility that editing-dependent initiation-codon remodeling can tune translational output in living cells, particularly through AUG-to-IUG-mediated derepression. Together, these findings establish a reporter-based framework in which A-to-I editing can remodel 5'-UTR initiation codons, while highlighting the need for endogenous protein-level and native-locus validation to determine physiological relevance.

RNA Editing↗
PubMed2026

Homozygous initiation codon-altering complex variant causes rapid-onset chorioretinopathy phenotype in ABCA4 disease.

PURPOSE: To characterize the clinical phenotype associated with a homozygous start codon-altering complex variant in the ABCA4 gene and evaluate its severity and prognosis in the context of Stargardt disease. METHODS: Patient records were retrospectively reviewed for homozygous ABCA4 start codon variants. Patients underwent ophthalmic exam, multimodal imaging, full-field electroretinography (ffERG), and inherited retinal disease panel testing. Structural and functional retinal assessments were reviewed to determine phenotype severity. RESULTS: Three brothers of Ashkenazi Jewish descent presented with profound early-onset vision loss beginning at age 7, with best-corrected visual acuity reduced to counting fingers or hand motion by early adulthood. Imaging revealed widespread macular atrophy, extensive intraretinal pigment migration, and near-complete foveal outer nuclear layer loss. ffERG demonstrated extinguished scotopic and photopic responses. The patients were found to be homozygous for a complex ABCA4 allele containing the start codon variant c.[1A&#x2009;>&#x2009;G;6089G&#x2009;>&#x2009;A]. These features were consistent with the rapid-onset chorioretinopathy phenotype, previously associated with null ABCA4 alleles. CONCLUSIONS: This report characterizes the clinical findings in patients homozygous for the c.[1A&#x2009;>&#x2009;G;6089G&#x2009;>&#x2009;A] variant in ABCA4, confirming its association with a severe, rapid-onset chorioretinopathy phenotype. The data support the pathogenic nature of this complex allele and expands the genotype-phenotype correlational spectrum of ABCA4-related disease, with implications for prognosis and genetic counseling.

Humans↗
PubMed2026

Detection of bacterial gene expression elements on Tobacco mosaic virus RNA using cDNA analysis.

Tobacco mosaic virus (TMV) is a positive-stranded RNA virus that infects plants. Interestingly, the 5'-untranslated region (UTR) of the TMV RNA genome is recognized and translated by the ribosomes of Escherichia coli in a Shine-Dalgarno (SD) sequence-independent manner. This study aimed at investigation of the bacterial recognition modules that control gene expression within the TMV RNA genome. To this end, the 5'-end-complete cDNA of the TMV RNA and several 5'-end-truncated cDNA mutants, in which the movement protein-encoding gene and its downstream region were replaced with a DNA sequence encoding a green fluorescent protein, i.e., monomeric Umikinoko-Green (mUkG1), were constructed. Surprisingly, mUkG1 fluorescence was observed in E. coli transformants harboring the cloned cDNAs, although they were inserted into a vector lacking a promoter. Analysis of the 5'-end-truncated cDNA mutants and promoter prediction suggested that an E. coli-specific promoter might be located 2.1 kb upstream of the initiation codon for mUkG1. Furthermore, Western blotting analysis and conversion of the initiation codon ATG to AGT indicated that the translation of mUkG1 started from the correct initiation codon. These results imply that E. coli ribosomes correctly recognize the initiation codon on the mRNA, irrespective of the overly long 5'-UTR. To the best of our knowledge, this report is the first to reveal a recognizable bacterial module hidden within the TMV RNA genome through cDNA construction.

Tobacco Mosaic Virus↗
PubMed2024

Mapping Start Codons of Small Open Reading Frames by N-Terminomics Approach.

sORF-encoded peptides (SEPs) refer to proteins encoded by small open reading frames (sORFs) with a length of less than 100 amino acids, which play an important role in various life activities. Analysis of known SEPs showed that using non-canonical initiation codons of SEPs was more common. However, the current analysis of SEP sequences mainly relies on bioinformatics prediction, and most of them use AUG as the start site, which may not be completely correct for SEPs. Chemical labeling was used to systematically analyze the N-terminal sequences of SEPs to accurately define the start sites of SEPs. By comparison, we found that dimethylation and guanidinylation are more efficient than acetylation. The ACN precipitation and heating precipitation performed better in SEP enrichment. As an N-terminal peptide enrichment material, Hexadhexaldehyde was superior to CNBr-activated agarose and NHS-activated agarose. Combining these methods, we identified 128 SEPs with 131 N-terminal sequences. Among them, two-thirds are novel N-terminal sequences, and most of them start from the 11-31st amino acids of the original sequence. Partial novel N-termini were produced by proteolysis or signal peptide removal. Some SEPs' transcription start sites were corrected to be non-AUG start codons. One novel start codon was validated using GFP-tag vectors. These results demonstrated that the chemical labeling approaches would be beneficial for identifying the start codons of sORFs and the real N-terminal of their encoded peptides, which helps better understand the characterization of SEPs.

Open Reading Frames↗
PubMed2025

Non-coding single-nucleotide and structural variants affecting the EYS putative promoter cause autosomal recessive retinitis pigmentosa.

PURPOSE: Variants in untranslated genomic regions are difficult to identify as pathogenic but are capable of causing disease by interfering with gene expression. This study aimed to characterize the effect of variants identified in the 5'-untranslated region of EYS in patients with autosomal recessive retinitis pigmentosa (RP). METHODS: Variant screening included gene panels, Sanger, exome, and genome sequencing. Functional validation included an electrophoretic mobility shift assay and various luciferase assays. RESULTS: Patients with RP from 6 EYS biallelic Arab-Muslim families harbored a 5' noncoding EYS variant, c.-453G>T, and 4 harbored a structural variant affecting the 5' noncoding exons. Electrophoretic mobility shift assay analysis revealed an effect on binding of transcription factors for c.-453G>T and a neighboring variant c.-454G>T. Dual luciferase assays using overexpression of various transcription factors showed distinct effects on expression. c.-453G>T was associated with higher luciferase expression with CRX overexpression and c.-454G>C with OTX2 overexpression. In addition, the 2 variants were found to influence translation by affecting upstream initiation codons. Interestingly, visual function of EYS RP patients who harbor c.-453G>T are better than those with biallelic null EYS variants. CONCLUSION: Our analysis revealed both single-nucleotide and structural variants in the EYS promoter as the cause of autosomal recessive RP. These variants may affect EYS expression via a dual mechanism by altering transcription factor binding affinity at the EYS promoter and by affecting upstream open reading frames.

Humans↗
PubMed2026

Cloning of human DING: Developmental expression and downregulation by EtOH in-utero.

INTRODUCTION: An estimated 15-20% of women consume alcohol (EtOH) during pregnancy. Women with alcohol use in early pregnancy are likely to have a child with fetal alcohol spectrum disorders (FASD). Recently, we reported neuroprotective effects of human DING (a member of the DING family of phosphatases) against EtOH-mediated toxicity in rats and in human fetal cortical neurons in vitro. Now, we report the sequencing and developmental expression patterns of endogenous DING in human fetal brain. METHODS: DING cDNA was cloned from human U87MG astrocytoma cells with primers specific to the plant DING gene and known prokaryotic DING genes. This cDNA was used to prepare antibodies. The full-length human DING gene p38hu (1095 nucleotide bases) is flanked by the first initiating codon, ATG, and the last, stop codon, TAA. Post-mortem fetal tissues and maternal blood were collected during pregnancy between 8 and 37 weeks' gestation. The developmental, spatial, and temporal expression of DING protein in fetal brain tissue was analyzed by immunohistochemistry. Developmental expression of DING in fetal brain and placenta was quantified by qWestern blots. DING promoter expression was assayed by ddPCR. Statistical analysis included ANOVA. RESULTS: Sequencing revealed different-sized genomic DNA clones. The anti-DING antibody detected proteins ranging in size from 35 to 40 kDa, and high molecular weight precursor protein in fetal brain and placenta. DING protein was present in fetal brain at early stages and its level was increased at later gestational ages. The DING promoter was expressed in fetal brain, neurospheres, and fetal brain-derived exosomes. DING levels were reduced in samples exposed to maternally consumed alcohol. CONCLUSIONS: Because DING is neuroprotective, its reduced expression in fetuses exposed to alcohol may suggest a mechanism that contributes to the pathogenesis of FASD, which could lead to the development of therapeutic tools aimed at preventing, ameliorating or reversing this prevalent group of syndromes that are implicated in as many as 5% of births world-wide.

DING gene cloning↗
PubMed2025

Male proband with intractable seizures and a de novo start-codon-disrupting variant in GLUL.

Bi-allelic variants in GLUL, encoding glutamine synthetase and responsible for the conversion of glutamate to glutamine, are associated with a severe recessive disease due to glutamine deficiency. A dominant disease mechanism was recently reported in nine females, all with a de novo single-nucleotide variant within the start codon or the 5' UTR of GLUL that truncates 17 amino acids of the protein product, including its critical N-terminal degron sequence. This truncation results in a disorder of abnormal glutamine synthetase stability and manifests as a phenotype of severe developmental and epileptic encephalopathy. Here, we report the first male with a pathogenic de novo variant in the same critical region of GLUL, with a phenotype of refractory focal and generalized seizures, as well as developmental delays. We provide a detailed description of the disease course and treatment response.

Humans↗
PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗
PubMed2020

GSK3&#x3b2;-Mediated Expression of CUG-Translated WT1 Is Critical for Tumor Progression.

The Wilms' tumor 1 (WT1) gene is well known as a chameleon gene. It plays a role as a tumor suppressor in Wilms' tumor but also acts as an oncogene in other cancers. Previously, our group reported that a canonical AUG starting site for the WT1 protein (augWT1) acts as a tumor suppressor, whereas a CUG starting site for the WT1 protein (cugWT1) functions as an oncogene. In this study, we report an oncogenic role of cugWT1 in the AOM/DSS-induced colon cancer mouse model and in a urethane-induced lung cancer model in mice lacking cugWT1. Development of chemically-induced tumors was significantly depressed in cugWT1-deficient mice. Moreover, glycogen synthase kinase 3&#x3b2; promoted phosphorylation of cugWT1 at S64, resulting in ubiquitination and degradation of the cugWT1 associated with the F-box-/- WD repeat-containing protein 8. Overall, our findings suggest that inhibition of cugWT1 expression provides a potential candidate target for therapy. SIGNIFICANCE: These findings demonstrate that CUG-translated WT1 plays an oncogenic role in vivo, and GSK3&#x3b2;-mediated phosphorylation of cugWT1 induces its ubiquitination and degradation in concert with FBXW8.

A549 Cells↗
PubMed2026

PKD1 upstream open reading frames affect Polycystin-1 expression and polycystic kidney disease phenotypes.

Autosomal dominant polycystic kidney disease (ADPKD) accounts for 5%-10% of prevalent end-stage kidney failure (ESKD). ADPKD cysts result from a loss of sufficient functional expression of PKD1/Polycystin-1 (PC1) in approximately 80% of families. Kidney disease severity correlates with the extent to which PC1 dosage is reduced below a critical level, and evidence suggests therapeutic benefit from increasing PC1 expression in these conditions. Upstream open reading frame (uORF) translation can reduce translation of a protein's coding sequence. Ribosome profiling data and bioinformatic predictions suggested the presence of conserved PKD1 uORFs, so we sought to explore their biological role. We generated luciferase reporters and two humanized PKD1 5' UTR mouse models with or without single nucleotide edits removing uORF start codons (&#x394;uORF) to define active uORFs and test their impact on PC1 translation. PKD1 uORF start codons can robustly initiate translation, and &#x394;uORF conveys a 2-4 fold increase in PC1 protein expression and resultant prevention of kidney cysts in Dnajb11 as well as in Pkd1 missense models. PKD1 uORF1-blocking steric antisense oligonucleotides (ASOs) substantially increase PC1 expression in vitro. PKD1 uORFs play an important role in the low basal expression of WT PKD1, and their inhibition represents an opportunity to therapeutically increase PC1 translation in polycystic kidney and liver disease resulting from reduced dosage of PC1.

Animals↗
PubMed2026

Ribosome stalling position, spacing, and A-site occupancy impact translation and cotranslational mRNA decay in plants.

Ribosomes can pause during mRNA translation, but what causes pausing, how pauses affect protein production, and whether they trigger cotranslational mRNA decay are poorly understood in plants. Here, we investigate the causes and consequences of ribosome pausing in Arabidopsis and maize. This is accomplished by sizing, mapping, and quantifying footprints of individual ribosomes (monosomes) and closely spaced ribosome pairs (disomes) at single-codon resolution on open reading frames (ORFs). Ribosome footprinting was combined with 5'P-degradome-seq to examine the coincidence of pausing with cotranslational decay under control conditions and brief hypoxia in Arabidopsis. The data resolve two monosome conformations and three disome configurations. These include monosomes with a vacant or occupied A-site and disomes that have collided or are separated by one or two codons. Pausing is prevalent at initiation, termination, and di-Proline codons. Di-Proline pauses do not trigger cotranslational decay but appear important in cotranslational protein processing. Brief hypoxia induces stalling of A-site vacant ribosomes at Aspartate codons, often coinciding with 5'P peaks, indicating that rate-limiting decoding can trigger cotranslational mRNA decay. Notably, actively transcribed and translated hypoxia-response mRNAs accumulate 1- to 2-codon-separated disomes and are actively degraded. Comparative analysis of footprints in the two species reveals ribosome conformations and codon-specific pausing can be conserved or lineage-specific, as exemplified by pausing at di-Prolines and on Conserved Peptide upstream ORFs. In sum, the stalling of ribosomes at specific codons, coupled with ribosome A-site occupancy and disome spacing, modulates protein production and cotranslational mRNA decay in plants.

Ribosomes↗
PubMed2026

Altered neuronal start codon stringency favors cap-independent repeat-associated non-AUG translation.

Intronic GGGGCC repeat expansions in C9orf72 cause amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). This expansion supports a non-canonical form of translational initiation known as repeat-associated non-AUG (RAN) translation to produce toxic dipeptide repeat proteins that contribute to neurodegeneration. Here, we find that the efficiency of RAN translation and its dependency on the 5' 7-methylguanosine mRNA cap are variable across cell types, with both rodent neurons and human iNeurons favoring cap-independent RAN translation from two distinct repeats (CGG and GGGGCC) across multiple reading frames. Treatment with an eIF4E inhibitor that blocks cap-dependent translation enhances RAN translation specifically in neurons. Intriguingly, cap-independent RAN translation exhibits less reliance on near-cognate codons for initiation than cap-dependent RAN translation. This finding led us to identify a surprising global alteration in neuronal start codon stringency as a contributor to the relatively higher cap-independent RAN translation in this cell type. This effect correlates with cytoplasmic redistribution of eIF1 in neurons and is reversed with overexpression of the eukaryotic initiation factor eIF5, which relaxes start codon stringency and preferentially enhances cap-dependent RAN translation. Together, these findings reveal several neuron-specific features of translational regulation that favor cap-independent RAN translation with implications for nucleotide repeat expansion disorder pathogenesis.

Neurons↗
PubMed2025

Discovery of functional factorless internal ribosome entry site-like structures through virome mining.

All viruses must co-opt the host translational machinery for viral protein synthesis. The dicistrovirus intergenic region internal ribosome entry site (IGR-IRES) utilizes the most streamlined translation mechanism by adopting a triple pseudoknot structure that directly recruits and binds within the intersubunit space of the ribosome and initiates translation from a non-AUG codon. The origin of this unprecedented mechanism is not known. Using a bioinformatics pipeline to examine the diversity and function of IRESs across RNA viromes, we searched for IRES-like RNA structures using RNA covariance models for multiple IRES sub-types, and tested functional IRES by using a dual-fluorescent lentiviral library reporter screen. We identified over >4,700 dicistro-like genomes with ~32% containing putative IRES structures, including novel viral genome arrangements with multiple IRESs and IRESs embedded within open-reading frames (ORFs). Predicted IRESs bound directly to purified ribosomes and supported internal ribosome entry activity in vitro and in vivo. Moreover, internal IRESs embedded within an ORF of monocistronic genomes were functional and operated simultaneously to produce the downstream ORF. We also identified IRES-like structures within non-dicistrovirus viral genomes, including in the families Tombusviridae and Narnaviridae that bound to ribosomes directly and a subset can direct internal ribosome entry. This study provides a framework to map the origin of factorless IRES mechanisms and study the diverse viral strategies utilizing RNA-based mechanisms.

Internal Ribosome Entry Sites↗
PubMed2026

Ribo-ITP enables identification of translons from limited input samples.

In the last decade, an unexpectedly large number of translated regions (translons) have been discovered using ribosome profiling and proteomics. Translons can act as regulatory elements or encode functional micropeptides. However, identification of translons has been limited to cell lines or large organs due to high input requirements for conventional ribosome profiling and mass spectrometry. Here, we address this input limitation using Ribo-ITP on difficult-to-collect samples such as microdissected hippocampal tissues and single preimplantation embryos to identify thousands of translons. To test the translational capacity of the identified translons, we engineer a translon-dependent GFP reporter system and detect expression of translons initiating at ATG and near-cognate start codons in mouse embryonic stem cells (mESCs). We identify distinct expression patterns of translons using a comparative analysis of more than a thousand ribosome profiling datasets across a wide range of cell types. Further, using a machine learning model, we predict that specific upstream translons in synaptically enriched mRNAs regulate translation efficiency of the annotated coding region. Taken together, we present a proof-of-concept study to identify non-canonical translation events from low input samples which can be applied to cell and tissue types inaccessible to conventional methods.

Animals↗
PubMed2026

The complete and annotated mitochondrial genome of Hemileia vastatrix Race I, causal agent of coffee leaf rust.

Hemileia vastatrix is the fungal pathogen responsible for coffee leaf rust (CLR), the most economically important disease of Coffea arabica worldwide. Recently, the nuclear genome of this fungus was completely deciphered. However, the mitochondrial genome of H. vastatrix has remained undercharacterized. Here, we present the complete, circularized mitochondrial genome of H. vastatrix Race I (isolate HvRI), assembled using a hybrid approach combining PacBio HiFi long reads and BGIseq short reads. The genome is 173,525&#xa0;bp in length with a GC content of 33.1% and encodes 41 functional genes, including 15 protein-coding genes, 2 rRNAs, and 24 tRNAs. The assembly reveals significant structural complexity, driven by intron expansion in the cox1 and cob genes. Notably, the atp8 gene contains a group II intron, rare for this locus, whose internal open reading frame displays evidence of pseudogenization via internal stop codons.. We also characterized a putative replication initiation zone (~1.2&#xa0;kb) defined by a poly-G homopolymer and conserved regulatory motifs. The mitogenome of the HvRI isolate does not contain cob mutations that lead to amino acid substitutions G143A and F129L associated with the quinone outside inhibitor (QoI) fungicide resistance. This high-quality mitogenome is an important resource for comparative mitogenomics, population diversity studies, and the molecular surveillance of QoI fungicide resistance.

Genome, Mitochondrial↗
PubMed2016

Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes.

In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

Amino Acid Sequence↗