SEARCH · PubMed Health

Results for “DNA, Z-Form”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed1992

Chromatin reconstitution on small DNA rings. IV. DNA supercoiling and nucleosome sequence preference.

Nucleosome formation on inverted repeats or on some alternations of purines and pyrimidines can be inhibited in vitro by DNA supercoiling through their supercoiling-induced structural transitions to cruciforms or Z-form DNA, respectively. We report here, as a result of study of single nucleosome reconstitutions on a DNA minicircle, that a physiological level of DNA supercoiling can also enhance nucleosome sequence preference. The 357 base-pair minicircle was composed of a promoter of phage SP6 RNA polymerase joined to a 256 base-pair fragment containing a sea urchin 5 S RNA gene. Nucleosome formation on the promoter was found to be enhanced on a topoisomer with in vivo superhelix density when compared to topoisomers of lower or higher superhelical densities, to the nicked circle, or to the linear DNA. In contrast, nucleosomes at other positions appeared to be insensitive to supercoiling. This observation relied on a novel procedure for the investigation of nucleosome positioning. The reconstituted circular chromatin was first linearized using a restriction endonuclease, and the linear chromatin so obtained was electrophoresed as nucleoprotein in a polyacrylamide gel. The gel showed well-fractionated bands whose mobilities were a V-like function of nucleosome positions, with the nucleosome near the middle migrating less. This behavior is similar to that previously observed for complexes of sequence-specific DNA-bending proteins with circularly permuted DNA fragments, and presumably reflects the change in the direction of the DNA axis between the entrance and the exit of the particle. Possible mechanisms for such supercoiling-induced modulation of nucleosome formation are discussed in the light of the supercoiling-dependent susceptibility to cleavage of the naked minicircle with S1 and Bal31 nucleases; and a comparison between DNase I cleavage patterns of the modulated nucleosome and of another, non-modulated, overlapping nucleosome.

Animals↗

PubMed1992

Elsamicin A can convert the Z-form of poly[d(G-C)] and poly[(G-m5C)] back to B-form DNA.

The interaction of poly[(G-C)] and poly[d(G-m5C)] with the antitumor antibiotic elsamicin A, which binds to alternating guanine + cytosine tracts in DNA, has been studied under the B and Z conformations. Both the rate and the extent of the B-to-Z transition are diminished by the antibiotic, as inferred by spectroscopic methods under ionic conditions that otherwise favor the left-handed conformation of the polynucleotides. Moreover, elsamicin converts the Z-form DNA back to the B-form. The circular dichroism data indicate that elsamicin binds to poly[d(G-C)] and poly[d(G-m5C)] to form a right-handed bound elsamicin region(s). The transition can be followed by changes of the molar ellipticity at 250 nm, thus providing a convenient wavelength to monitor the Z-to-B conformational change of the polymers as elsamicin is added. The elsamicin A effect might be explained by a model in which the antibiotic binds preferently to a B-form DNA, playing a role as an allosteric effector on the equilibrium between the B and Z conformations, thus favoring the right-handed one.

Aminoglycosides↗

PubMed1992

Human autoantibody binding to multiple conformations of DNA.

Systemic lupus erythematosus and rheumatoid arthritis in humans are characterized by circulating and tissue fixed autoantibodies reactive with self antigens including nucleic acids and other nuclear components. Native calf thymus DNA (B-form), DNA.RNA hybrid (A-form), and left handed DNA (Z-form) were reactive with autoantibodies derived from SLE sera. Inhibition studies suggest that antibodies are recognizing multiple conformations presented by altogether different polymers and A- or Z-DNA might be the immunogenic stimulus for the production of antibodies cross reactive with native DNA.

Antibodies, Antinuclear↗

PubMed2026

Biofilm-derived curli and Z-DNA shape anti-DNA antibody responses during Salmonella infections.

Antibodies to Z-DNA, a non-canonical DNA conformation with a left-handed zigzag backbone, are abundant in the serum of patients with systemic lupus erythematosus (SLE), with levels increasing with disease activity and flares. As SLE is associated with bacterial infections, and as extracellular DNA (eDNA) within biofilms of several bacterial species has been shown to adopt the Z-DNA conformation, bacterial Z-DNA may represent a source of immunogenic Z-DNA in SLE and other related autoimmune conditions. In these studies, we investigated whether eDNA in Salmonella biofilms also contained Z-DNA and whether such Z-DNA could elicit an antibody response. Using antibody-based staining approaches, we observed abundant eDNA in Salmonella enterica serovar Typhimurium (STm) biofilms in both the Z- and canonical B-DNA configurations, consistent with the highly Z-prone nature of the GC-rich Salmonella genome. To assess the functional contribution of these DNA conformations to biofilm integrity, biofilms were treated with DNase I, which lacks enzymatic activity against Z-DNA, or with benzonase, a nonspecific nuclease that degrades both B- and Z-DNA. DNase I treatment applied after biofilm maturation was less effective at thinning biofilms than treatment during early biofilm formation, a pattern also observed with benzonase treatment. Purified curli:DNA complexes contained Z-DNA and, when administered intraperitoneally to mice, elicited robust anti-Z-DNA antibody responses. Similarly, infection with invasive STm induced the production of anti-Z-DNA antibodies in vivo. Moreover, STm infection in mice fed a diet that promotes biofilm development was associated with increased Z-DNA levels in the cecal lumen and elevated anti-DNA antibody responses. Collectively, these findings suggest that Z-DNA, likely formed by extruded Salmonella genomic DNA, and embedded within curli:DNA complexes of STm biofilms, triggers a host immune response and drives anti-Z-DNA antibody production. This work provides mechanistic insight into how bacterial infections and diet-dependent modulation of biofilm formation may contribute to anti-Z-DNA antibody responses in autoimmune diseases like SLE.

Animals↗

PubMedDate not supplied

[Nitrogen mustard fixes the Z-conformation in poly[d(G-C)]poly[d(G-C)] and DNA].

The reactions of poly(dG-dC).poly(dG-dC) and (dG-dC)10 insert in the plasmid pGC20 with N-methyl-bis(2-chloroethyl)-amine (nitrogen mustard, HN-2) have been studied. It is shown that nitrogen mustard does not induce the B----Z transition in poly(dG-dC).poly(dG-dC), but produces fixation of the polynucleotide Z-conformation once this exists. In the case of pGC20 plasmid DNA, nitrogen mustard also fixes Z-form of the (dG-dC)-insert. The rate constant of the reaction of nitrogen mustard with guanine in the polynucleotide (k = 9,0.10(-3) min-1) is about one-third of that for the fixation of Z-form of the (dG-dC)-insert in the plasmid (k1 = 2,8.10(-2) min-1) which is attributed to a greater rate of formation of diguanyl derivative in the opposite DNA chains. It is suggested that nitrogen mustard is capable of fixing the Z-form DNA not only in vitro, but also in vivo.

Circular Dichroism↗

PubMed1991

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.

Animals↗

PubMed1992

Synthesis and properties of mirror-image DNA.

We have investigated the conformations of the hexadeoxyribonucleotide, L-d(CGCGCG) composed of L-deoxyribose, the mirror image molecule of natural D-deoxyribose. In this paper, we report the synthesis of four L-deoxynucleosides and the L-oligonucleotide-ethidium bromide interactions. The L-deoxyribose synthon 9 was synthesized from L-arabinose with an over all yield of 28.5% via the Barton-McCombie reaction. The L-deoxynucleosides were obtained by a glycosylation of appropriate nucleobase derivatives with the 1-chloro sugar 9. After derivatization to nucleoside phosphoramidites, L-deoxycytidine and L-deoxyguanosine were incorporated into a hexadeoxynucleotide, L-d(CGCGCG) by a solid-phase beta-cyanoethylphosphoramidite method. This L-hexanucleotide was resistant to digestion with nuclease P1. The conformations of L-d(CGCGCG) were an exact mirror image of that of the corresponding natural one as described previously, and the conformations of the L-d(CGCGCG)-ethidium bromide complex were also the mirror images of those of the D-d(CGCGCG)-ethidium bromide complex under both low and high salt conditions. These results suggest that ethidium bromide prefers not a right-handed helical sense, but the base-base stacking geometry of the B-form rather than that of the Z-form. Thus, L-DNA would be a useful tool for studying DNA-drug interactions.

Chromatography, High Pressure Liquid↗

PubMed1992

Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae.

A putative Z-DNA binding protein, named zuotin, was purified from a yeast nuclear extract by means of a Z-DNA binding assay using [32P]poly(dG-m5dC) and [32P]oligo(dG-Br5dC)22 in the presence of B-DNA competitor. Poly(dG-Br5dC) in the Z-form competed well for the binding of a zuotin containing fraction, but salmon sperm DNA, poly(dG-dC) and poly(dA-dT) were not effective. Negatively supercoiled plasmid pUC19 did not compete, whereas an otherwise identical plasmid pUC19(CG), which contained a (dG-dC)7 segment in the Z-form was an excellent competitor. A Southwestern blot using [32P]poly(dG-m5dC) as a probe in the presence of MgCl2 identified a protein having a molecular weight of 51 kDa. The 51 kDa zuotin was partially sequenced at the N-terminal and the gene, ZUO1, was cloned, sequenced and expressed in Escherichia coli; the expressed zuotin showed similar Z-DNA binding activity, but with lower affinity than zuotin that had been partially purified from yeast. Zuotin was deduced to have a number of potential phosphorylation sites including two CDC28 (homologous to the human and Schizosaccharomyces pombe cdc2) phosphorylation sites. The hexapeptide motif KYHPDK was found in zuotin as well as in several yeast proteins, DnaJ of E.coli, csp29 and csp32 proteins of Drosophila and the small t and large T antigens of the polyoma virus. A 60 amino acid segment of zuotin has similarity to several histone H1 sequences. Disruption of ZUO1 in yeast resulted in a slow growth phenotype.

Amino Acid Sequence↗

PubMed1991

1H and 31P nuclear magnetic resonance studies of spermine binding to the Z-DNA form of d(m5CGm5CGm5CG)2. Evidence for decreased spermine mobility.

The binding of spermine to the d(m5CGm5CGm5CG) duplex has been studied by proton and phosphorus nuclear magnetic resonance techniques in order to investigate the mobility and nature of spermine bound to the resulting Z-DNA complex. A characterization of the B to Z transition as a function of increasing spermine concentration demonstrated doubling of the non-exchangeable proton and the phosphorus peaks at a ratio of about 1:1 (spermine/duplex) and a re-simplification of the spectrum at 2:1 (spermine/duplex) where about 90% or the DNA was fully converted into the Z-form. However, some of the Z-DNA proton chemical shifts differed between the 1:1 and 2:1 titration points. Since these differences involved primarily the exchangeable terminal imino and amino protons, they could result from end effects. Discrepancies were generally not observed with the non-terminal proton shifts nor with the phosphorus shifts. These proton and phosphorus chemical shift changes are fully consistent with a B to Z transition. Complexed spermine peaks appear about 0.1 parts per million upfield from the uncomplexed form. The spermine and both the B and Z-DNA hexamer signals are noticeably broadened at the 1:1 ratio but the remaining signals re-sharpen at the 2:1 ratio. Both one-dimensional and two-dimensional studies revealed negative nuclear Overhauser effect (NOE) contacts between each spermine proton. Therefore, spermine has a longer correlation time than that observed for unbounded spermine. These results are contrasted with the positive NOE contacts observed for the B-DNA-spermine complexes reported by Wemmer et al. using the dodecamer d(CGCGAATTCGCG)2 and reported here using the hexamer d(ATGCAT)2. While the mobility of spermine in the Z-DNA complex is significantly less than that of the B-DNA complex, no clear evidence of intermolecular spermine-DNA proton NOE contacts is observed.

Base Sequence↗

PubMed1991

Spectrophotometrical and immunochemical studies on the conformational changes in poly(dG-dC).poly(dG-dC) after modification by 4-hydroxyaminoquinoline 1-oxide.

Poly(dG-dC).poly(dG-dC) was modified by the reaction with 4-hydroxyaminoquinoline 1-oxide (4HAQO) in the presence of seryl-AMP. The conformations of 4HAQO-modified poly(dG-dC).poly(dG-dC) and of poly(dG-dC).poly(dG-dC) were studied by circular dichroism spectra under various salt concentration conditions. 4HAQO residues to guanine bases are inefficient in inducing the transition of poly(dG-dC).poly(dG-dC) from B-form to Z-form conformation. We have elicited monoclonal antibodies against 4HAQO-poly(dG-dC).poly(dG-dC). They were characterized using enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and binding to supercoiled DNA. These antibodies reacted with 4HAQO-poly(dG-dC).poly(dG-dC) specifically but not with 4HAQO-modified DNA or poly(dG).poly(dC). However, they cross-reacted with N-acetoxy-2-acetylaminofluorene-modified poly(dG-dC).poly(dG-dC) in Z-form conformation. These monoclonal antibodies may recognize a unique conformation in poly(dG-dC).poly(dG-dC) after 4HAQO modification.

4-Hydroxyaminoquinoline-1-oxide↗

PubMedDate not supplied

[Comparison of the state of the area between B- and Z-segments of superhelical plasmids in vitro and in situ].

The structure of B-Z junction in a cloned plasmid pGC20 containing a (dG-dC)10 insert at the SmaI site has been studied in vitro and in situ by modifying the DNA with O-beta-diethylaminoethylhydroxylamine (OHA). The latter is an analog of hydroxylamine possessing specificity with respect to unpaired cytidine. Experiments in vitro showed a complicated pattern of inhibiting the restriction hydrolysis of the OHA-modified DNA within the polylinker region of the plasmid. As the duration of the DNA reaction with OHA grows, a gradual increase in the inhibition of restriction is observed at the BamHI site neighboring the Z-insert and at the HindIII site at a distance of about 30 bp from the insert, while an intact segment (containing the SalGI site) is retained in the intermediate region. On passing to the cell level, only the region immediately adjacent to the Z-insert appears to be modified. According to estimates, about 30 to 40% of pGC20 molecules have the (dG-dC)10 insert in the Z-form when modified in situ in 1M OHA, pH 5.0.

Base Sequence↗

PubMed1992

[Detection of left-helical segments in eukaryotic DNA].

The method of DNA binding to nitrocellulose filters was applied to DNA isolated from mouse liver and Ehrlich ascite carcinoma (EAC), calf thymus, and lymphocytes from patients with chronic lymphoid leukemia. In those and phage PM2 DNA the increase in the DNA binding to the filters with a rise in NaCl concentration from 0.5 up to 4.5 M was sigmoidal being suggestive of a conformational transition. No such activity was found in the case of phage lambda or single-stranded DNA. The binding decreased dramatically after mild cleavage of DNA with DNAase I or treatment with phospholipase C or Eco RI and Hin PI restrictases. Incubation of DNA with ethidium bromide led to decrease in the amount of bound DNA. This effect was enhanced with a rise in the dye concentration. The isotherms of ethidium bromide binding to eukaryotic DNA obtained in Scatchard plots by optic titration had a component with a positive slope at low values of r. Bivalent ions (Mg2+, Zn2+) shifting the equilibrium towards the Z-form increased the proportion of macromolecules retained on the filters at NaCl concentrations of 1-3 M. Local changes in the helix conformation were studied with the help of chemical probes: diethylpyrocarbonate (guanine Z-DNA) and osmium-pyridine reagent (pyrimidines of boundary B-Z sites). These probes incorporation into samples of liver DNA, EAC, and lymphocytes resulted in chemical modification of all these samples. Modification of DNA by osmium-pyridine reagent led to inhibition of subsequent restriction by Eco RI restrictase. The data obtained are suggestive of the presence of Z-regions in the B-helix of eukaryotic DNA. A topological model of Z-site stabilization in small superhelical loops of DNA fixed by protein or lipoprotein molecules is proposed.

Animals↗

PubMed1992

A 1H-NMR study of the DNA binding characteristics of thioformyldistamycin, an amide isosteric lexitropsin.

The interaction of thioformyldistamycin, an amide isostere of the naturally occurring antibiotic distamycin A, with a self-complementary decadeoxynucleotide duplex, d(CGCAATTGCG)2, has been examined using a variety of high-field 1H-NMR techniques. The ligand exhibits two forms in solution arising from geometric isomerism due to restricted rotation around the thioformamide bond. Only the thermodynamically more stable Z-form is shown to bind to the oligonucleotide along its minor groove at the central 5'-AATT segment with the end groups of the ligand extending into the flanking GC regions but without any close contact at the amidinium terminus. Cross-peaks involving characteristic intra- and interresidue proton connectivities in the 2D experiments (COSY and NOESY) were employed to assign individual resonances of both strands in the asymmetric DNA-drug complex. The solution structure of the complex was constructed by molecular mechanics calculations based upon initial estimates of drug-DNA NOE contacts and further refined through energy minimization. These results complement previous structural studies on distamycin and other lexitropsins with oligonucleotides. The exchange of the ligand between two equivalent binding sites on the DNA sequence was estimated to occur at 40 s-1 with a free energy of activation of 16.5 kcal.mol-1 at 321-326 K. There was no evidence of formation of a 2:1 drug-oligomer complex, in contrast to the case of the natural product, which is attributed to steric demands of the larger sulfur atom.

Base Sequence↗

PubMed1991

DNA hairpin loops in solution. Correlation between primary structure, thermostability and reactivity with single-strand-specific nuclease from mung bean.

Hairpin structures formed by seven DNA inverted repeats have been studied by PAGE, UV(CD)-spectroscopy and nuclease cleavage. The hairpins consisted of (CG)3 stems and loops of 2, 3 and 4 residues. Thermal stabilities (Tm) have been determined in low and high ionic strength buffers, where the hairpins were structured in the B- and Z-DNA form respectively. The thermodynamic parameters of hairpin formation have been obtained by a two-state analysis of the hairpin-coil transitions. It is found that, on increasing the number of bases in the loop from 2 to 3 and 4, the Tms of the B-hairpins decrease, whereas the Tms of the same hairpins in the Z-form increase. This confirms previous evidence (1,2) that in a hairpin molecule the size and structure of the loop are modulated by the conformation of the helical stem. Moreover, B-hairpins with loops comprising 2, 3 and 4 bases have been digested with the single-strand-specific nuclease from mung bean. In our experimental conditions (0 degrees C) the nuclease preferentially cleaves the unbonded nucleotides of the loops. However, the rates of loop hydrolysis, which roughly follow a first-order kinetics, markedly depend on the size of the loop. At a ratio of 3 enzyme units/micrograms DNA, the half-lives of hairpins which are expected to form loops of 4, 3 and 2 residues are 90, 145 and 440 minutes respectively. Thermostability and enzymatic digestion data suggest that two-membered loops can be formed in B-hairpins but not in Z-hairpins.

Base Sequence↗

PubMed1991

Destabilization of the duplex and the high-salt Z-form of poly(dG-methyl5dC) by substitution of ethyl for the 5-methyl group.

The B-to-Z conformational transition of poly(dG-dC) is highly promoted by 5-methyl substitution of the dC moiety, i.e. in poly(dG-methyl5dC). By the synthesis of a new poly(dG-dC) analogue, poly(dG-ethyl5dC), the effect of a longer alkyl-chain substituent of dC on structure and conformation has been studied with ultraviolet absorption melting profiles and circular dichroism spectroscopy. The 5-ethyl substituent in poly(dG-ethyl5dC) destabilizes the duplex structure against thermal denaturation compared with both poly(dG-methyl5dC) and poly(dG-dC). C.d. studies also reveal that for the high-salt B-Z transition of poly(dG-ethyl5dC) a higher NaCl concentration is required than for that of poly(dG-methyl5dC), although much lower than for poly(dG-dC). However low-salt Z-DNA in poly(dG-ethyl5dC) shows unique features, e.g. it needs no divalent cations to be stable. The low-salt B-Z transition of poly(dG-ethyl5dC) can also be observed by the absorption-temperature melting profile, in contrast to both poly(dG-methyl5dC) and poly(dG-dC). The effects of MgCl2 concentration, temperature, acid pH and trifluorethanol on the conformation of poly(dG-ethyl5dC) have also been determined.

Circular Dichroism↗

PubMed1992

9-aminoacridine inhibits the B-Z transition of poly(dA-dT).

9-Aminoacridine is the parent compound of a family of pharmacologically active model substances that bind to DNA through intercalation between base pairs. In the present study we show that 9-aminoacridine inhibits the B-to-Z isomerization of poly(dA-dT) in conditions that otherwise cause it to occur (5 M NaCl and 123 mM Ni(ClO4)2). Higher concentrations of Ni(ClO4)2 (155 mM) are able to induce the Z-form due to the disruption of the drug-polynucleotide interaction by the metal ion. Additionally, the dye reverses the Z-form in certain conditions. Thus, the data from this study indicate that 9-aminoacridine binds preferentially to the B-form of poly(dA-dT).

Aminacrine↗

PubMed1992

Vibrational circular dichroism studies of the A-to-B conformational transition in DNA.

The vibrational circular dichroism (VCD) spectra of several natural DNAs as well as tRNA, poly(dG-dC).poly(dG-dC), and poly(dA-dT).poly(dA-dT) are reported for the base deformation modes in the IR region from 1700 to 1550 cm-1 for the polymers in D2O as well as in high alcohol dehydrating conditions. Spectra of both the B- and A-forms were identified. The A-form DNA VCD, not previously reported, has characteristics that can be found in the VCD spectra of RNAs as would be expected from the similarity of their structures. The VCD is sequence-dependent. Under the dehydrating conditions studied, poly(dA-dT)poly(dA-dT),poly(dA).poly(dT), and a high-A-T fraction natural DNA had a different bandshape from the other DNAs, which was similar to that of poly(rA).poly(rU). Poly(dG-dC).poly-(dG-dC) did not form an A-form in high-alcohol conditions but instead had a VCD spectrum much like that of its high-salt-induced Z-form. Qualitative differences seen experimentally between A- and B-form DNA VCD were suggested by the differences in the coupled oscillator VCD calculated for the two forms.

Animals↗

PubMed1991

Potassium permanganate as an in situ probe for B-Z and Z-Z junctions.

The availability of DNA structural probes that can be applied to living cells is essential for the analysis of biological functions of unusual DNA structures adopted in vivo. We have developed a chemical probe assay to detect and quantitate left-handed Z-DNA structures in recombinant plasmids in growing E. coli cells. Potassium permanganate selectively reacts with B-Z or Z-Z junction regions in supercoiled plasmids harbored in the cells. Restriction enzyme recognition sites located at these junctions are not cleaved by the corresponding endonuclease after modification with KMnO4. This inhibition of cleavage allows the determination of the relative amounts of B- and Z-forms of the cloned inserts inside the cell. We have successfully applied this method to monitor the extent of Z-DNA formation in E. coli as a function of the growth phase and mutated topoisomerase or gyrase activities. The assay can in principle be used for any unusual DNA structure that contains a restriction recognition site inside or near the structural alteration. It can be a useful tool to analyze in vivo correlations between DNA structure and gene regulatory events.

DNA Restriction Enzymes↗