PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “ELASTIN”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

Elastin peptides induce migration and terminal differentiation of cultured keratinocytes via 67 kDa elastin receptor in vitro: 67 kDa elastin receptor is expressed in the keratinocytes eliminating elastic materials in elastosis perforans serpiginosa.

To delineate the molecular mechanism of transepidermal elimination of dermal elastic materials in elastosis perforans serpiginosa, the interaction between elastin and cultured keratinocytes was studied in vitro. Synthetic elastin peptide VGVAPG elicited chemotactic responses to the cultured keratinocytes at the dose of 10-9 M. Treatment of keratinocytes with 10-6 or 10-5 M elastin peptides resulted in the suppression of cell growth and the increased expression of involucrin and transglutaminase-1, markers of terminal differentiation. When cultured keratinocytes were treated with the elastin peptides, the expression of 67 kDa elastin receptor was increased. The induction of terminal differentiation by elastin peptides was attenuated by the treatment with the combination of anti-67 kDa elastin receptor antibody. The results indicate that elastin is a potent inducer of migration and terminal differentiation of cultured keratinocytes, which is mediated by the 67 kDa elastin receptor. In the lesional skins of patients with elastosis perforans serpiginosa, the 67 kDa elastin receptor was specifically expressed in the epidermis immediately surrounding the elastic materials that were being eliminated. The elastin receptor may be involved in the interaction between keratinocytes and elastin in elastosis perforans serpiginosa.

Cell Differentiation↗

Elastin as a self-organizing biomaterial: use of recombinantly expressed human elastin polypeptides as a model for investigations of structure and self-assembly of elastin.

Elastin is the major extracellular matrix protein of large arteries such as the aorta, imparting characteristics of extensibility and elastic recoil. Once laid down in tissues, polymeric elastin is not subject to turnover, but is able to sustain its mechanical resilience through thousands of millions of cycles of extension and recoil. Elastin consists of ca. 36 domains with alternating hydrophobic and cross-linking characteristics. It has been suggested that these hydrophobic domains, predominantly containing glycine, proline, leucine and valine, often occurring in tandemly repeated sequences, are responsible for the ability of elastin to align monomeric chains for covalent cross-linking. We have shown that small, recombinantly expressed polypeptides based on sequences of human elastin contain sufficient information to self-organize into fibrillar structures and promote the formation of lysine-derived cross-links. These cross-linked polypeptides can also be fabricated into membrane structures that have solubility and mechanical properties reminiscent of native insoluble elastin. Understanding the basis of the self-organizational ability of elastin-based polypeptides may provide important clues for the general design of self-assembling biomaterials.

Amino Acid Sequence↗

Synthesis of elastin in aortas from chick embryos. Conversion of newly secreted elastin to cross-linked elastin without apparent proteolysis of the molecule.

The biosynthesis of elastin was examined in matrix-free cells isolated by enzymic digestion of aortas from 17-day old chick embryos. After the cells were incubated with [14C]proline and then were rapidly boiled in buffer containing high concentrations of protease inhibitors and sodiumdodecyl sulfate, about one-quarter of the intracellular 14C-labeled protein was recovered as an elastin component with an apparent molecular weight of about 72 000. Examination of the medium from the cell suspension indicated that the largest elastin component secreted by the cells also had an apparent molecular weight of about 72 000. Pulse-chase experiments with intact aortas demonstrated that about two-thirds of the 72 000-dalton component disappeared in 2 h, apparently because it was converted to cross-linked fibers. When cross-linking was inhibited with penicillamine, the 72 000-dalton component persisted in the tissue 5 h. When cross-linking was inhibited with beta-aminopropionitrile, the elastin component of 72 000 daltons persisted for about 2 h, but thereafter it was gradually degraded to small peptides which were recovered in the incubation medium. The results suggest that elastin is secreted by cells in chick aorta as a polypeptide of about 72 000 daltons and that the secreted protein is incorporated into elastin fibers without cleavage to a protein of considerably smaller size.

Animals↗

Characteristic interaction of Ca2+ ions with elastin coacervate: ion transport study across coacervate layers of alpha-elastin and elastin model polypeptide, (Val-Pro-Gly-Val-Gly)n.

Ion transport characteristics across a macrocoacervate layer membrane composed of aqueous elastin model polypeptides with a specific repeating pentapeptide sequence, H-(Val-Pro-Gly-Val-Gly)n-Val-OMe (n > or = 40), were investigated. Transmembrane potential responses for NaCl. MgCl2, and CaCl2 concentration-cell systems were measured and examined systematically by comparing with those across a coacervate membrane composed of bovine neck ligamental alpha-elastin. In the case of the NaCl and MgCl2 systems, potential responses across these protein liquid membranes were different noticeably from each other depending upon the molecular structure with and without charged peptide side chains, whereas in the CaCl2 systems the transmembrane potential responses across the noncharged polypentapeptide coacervate membrane were comparable with those across the alpha-elastin coacervate membrane carrying both the positively and negatively charged amino acid residues as an amphoteric ion-exchange membrane. These results indicated that mechanisms of major Ca2+ ion transport are based on the specific and selective interactions with electrically neutral sites of elastin, such as the polypentapeptide backbone chain.

Amino Acid Sequence↗

Elastin synthesis by ligamentum nuchae fibroblasts: effects of culture conditions and extracellular matrix on elastin production.

Fetal bovine ligamentum nuchae fibroblasts maintained in culture synthesized soluble elastin but were unable to form the insoluble elastic fiber. Secreted elastin precursors accumulated in culture medium and were measured using a radioimmunoassay for elastin. When elastin production was examined in ligament tissue from fetal calves of various gestational ages, cells from tissue taken during the last trimester of development produced significantly more elastin than did cells from younger fetal tissue, with maximal elastin synthesis occurring shortly before birth. Soluble elastin was detected in ligament cells plated at low density until proliferation began to be density inhibited and the cells became quiescent. Also, soluble elastin production per cell declined with increasing population doubling or with age in culture. Cells grown in the presence of 5% fetal calf serum produced approximately four times as much soluble elastin as cells grown in serum-free medium. The addition of dexamethasone (0.1 microM) and bleomycin (1 microgram/ml) increased soluble elastin production by cultured cells 180% and 50%, respectively, whereas theophylline (5 micrograms/ml) depressed production 50% and antagonized stimulation by dexamethasone. Ascorbate (50 micrograms/ml), soybean trypsin inhibitor (1 mg/ml), insulin (100 microunits/ml), and aminoacetonitrile (50 micrograms/ml) had no effect, but cycloheximide at 10(-4) M completely inhibited soluble elastin production. In contrast to cells in culture, ligament tissue minces (ligament cells surrounded by in vivo extracellular matrix) efficiently incorporated soluble elastin precursors into insoluble, cross-linked elastin. In addition, soluble elastin production per cell (per microgram of DNA) was higher in tissue minces than elastin production by cells maintained on plastic. These results suggest a role for extracellular matrix in formation of the elastic fiber and in stabilizing elastin phenotypic expression by ligament fibroblasts. Fibroblasts from the bovine ligamentum nuchae present an excellent model for in vitro studies of elastin biosynthesis.

Animals↗

Binding of some metastatic tumor cell lines to fibrous elastin and elastin peptides.

Recent suggestions that tumor-cell targeting of elastin-rich tissues (e.g., lung) correlates with the presence of surface elastin receptors have been investigated. Receptors for insoluble (fibrous) elastin and for soluble elastin peptides have been implemented in these correlations. A rapid assay for binding of insoluble elastin has been devised. Two of the cell lines tested (M27 and MAT-LyLu), which metastasize to the lung, strongly bound fibrous elastin whereas a third (B16-F10) did not. None of 4 metastatic cell lines that do not target the lung (A549, 3LL, TA3, TA3-iso2) bound fibrous elastin. The ability of cell lines to interact with soluble elastin was tested by cell attachment to high-molecular-weight soluble elastin peptides adsorbed on a plastic surface. Three of 7 tested cell lines, B16-F10, M27 and TA3, attached to a soluble elastin coating. In contrast to the rapid binding of insoluble elastin particles, the cell interaction with immobilized soluble elastin peptides was delayed, suggesting that induction of receptors for soluble elastin and/or modification of the elastin coat was occurring. Thus, all 3 tested cell lines where metastases target the lung, namely, MAT-LyLu, B16-F10 and M-27, show soluble- or insoluble-elastin interactions, whereas, of 4 cell lines not targeting lungs, only one, TA3, reacts with soluble elastin.

Adenocarcinoma↗

Mechanisms of interaction between human skin fibroblasts and elastin: differences between elastin fibres and derived peptides.

3H-Labelled kappa-elastin peptides (kE:75 kDa molecular weight) were shown to bind to confluent human skin fibroblast (HSF) cultures in a time-dependent and saturable manner. Scatchard analysis indicated the presence of high affinity binding sites with kD = 2.7 x 10(-10) M and 19,000 sites per cell. Binding of kE to its receptor on HSF accelerates and intensifies the adhesion of insoluble elastin fibres (iE) to confluent HSF. Optimal effect was attained for a kE concentration of 0.3 x 10(-9) M close to kD. This stimulatory effect of kE on the binding of iE to HSF could be inhibited by neomycin, retinal and pertussis toxin, substances which act at different levels of the transduction mechanism following the activation of the receptor and the subsequent triggering of cell biological events (chemotaxis, modification of calcium fluxes). The stimulation of iE adhesion to HSF induced by kE as well as kE binding to the cells could be inhibited by lactose and laminin but not by Arg-Gly-Asp-Ser(RGDS) peptides. This indicates that the elastin peptide receptor on HSF possesses lectin-like properties and shares homology with the laminin receptor as also shown for other cell types. None of the substances tested, that is inhibitors of the transduction mechanism, lactose, laminin and Arg-Gly-Asp-Ser(RGDS) peptides were shown to interfere significantly with the binding of iE (in the absence of added kE) to confluent HSF. The proteins adhering strongly to elastin fibres were isolated by a sequential extraction procedure and the final hydrochloride guanidinium-DTT extract was analysed by SDS-PAGE under reducing conditions, Western blots using specific antibodies against several connective tissue proteins and affinity for [3H]-kE following nitrocellulose electro-transfer of proteins. Fibronectin, vitronectin, tropoelastin(s), and a 120 kDa cysteine rich glycoprotein previously designated as elastonectin were identified. Among these proteins, [3H]-kE was found to bind exclusively to a 65 kDa protein that could be eluted selectively from elastin fibres with a neutral buffer containing 100 mM lactose. Therefore the elastin peptide receptor on human skin fibroblasts shares properties with the elastin receptor characterized from other cell types. Conformational differences between elastin peptides and elastin fibres could explain the differences in the mechanisms of interactions between elastin fibres and elastin peptides with HSF in culture. The stimulatory effect of elastin-derived peptides on the adhesion of elastin fibres to HSF could have implications in the oriented biosynthesis of elastin fibres.

Adult↗

Effect of elastin on the calcification rate of collagen-elastin matrix systems.

The role of elastin in the aortic wall calcification and involved mechanisms were investigated. The major hypothesis of this work is that elastin is one of the major components to regulate calcification of bioprosthetic heart valve (BHV). The relationship between the elastin content and the calcification rate of the aortic wall was established using collagen-elastin matrices (CEM) made of varying ratios of collagen and elastin (90 and 10, 50 and 50, and 20 and 80). Biophysical characterization of CEM was performed by water content measurement and the tensile strength test. The conformational changes of the calcifiable matrix were evaluated as a function of elastin content using Fourier transform infrared (FTIR) spectroscopy. The calcium contents in CEM implanted in the rat subcutaneous model for 7 days were measured using atomic absorption (AA) spectroscopy. As the concentration of elastin in CEM increased from 10 to 80%, the total amount of calcium accumulated in CEM also increased. The calcium level in CEM containing the collagen and an elastin ratio of 20:80 was 20.16 +/- 0.70 microg/mg compared with 1.96 +/- 0.04 microg/mg in CEM containing the collagen and an elastin ratio of 90:10. The calcification rate of CEM pretreated with ethanol increased, as the elastin concentration in the CEM. However, the calcification rate of CEM pretreated with ethanol is significantly lower than that of the untreated control. The permeation rate of ethanol through CEM with the collagen and an elastin ratio of 20:80 (0.37 +/- 0.13 mmol/cm(2)/h) is significantly smaller than that through CEM with 90:10 (0.94 +/- 0.27 mmol/cm(2)/h). These results indicate that elastin has a significant role in tissue calcification and that elastin's resistance to ethanol penetration partially contributes less effectiveness of ethanol on aortic wall calcification.

Aorta↗

Characterization of insoluble elastin from copper-deficient pigs. Its usefulness in elastin sequence studies.

Insoluble elastin from copper-deficient animals has an amino acid composition intermediate between mature elastin and salt-soluble elastin (a higher lysine content and correspondingly low number of cross-links relative to the normal protein) and is solubilized by successive treatment with trypsin and chymotrypsin at 4 and 37 degrees C. Small amounts of B3H4 (11 mg--2 g of elastin) reduced allysine, allysine aldol, dehydronorleucine, and dehydromerodesmosine in insoluble elastin from copper-deficient pig aorta. In contrast, desmosine and isodesmosine were reduced only when a large excess of reductant (400 mg borohydride) was included in the reaction mixture. Reduction studies indicated that lysinonorleucine and merodesmosine were present in their dehydro forms to a greater extent in copper-deficient pig elastin than in normal elastin. After reduction with borohydride approximately 35% of the reduced form of the insoluble elastin remained insoluble after digestion with trypsin and chymotrypsin. A peptide containing the aldehyde oxidation product of lysine (allysine) and demonstrating an enrichment in glutamic acid was purified from the reduced form of copper-deficient pig elastin and partially sequenced. Its sequence (Gly-Ala-Glu-allysine-(Glu)...) and amino acid composition suggest: (1) clustering of glutamic acid residues in the elastin molecule, and (2) that allysine residues are not restricted to the alanine-enriched sites described for other elastin cross-links. Insoluble elastin from copper-deficient animals promises to be a useful tool for elastin sequence studies.

Amino Acid Sequence↗

Influence of elastin gene polymorphism on the elastin content of the aorta: A study in 2 strains of rat.

The elastin content in the thoracic aorta of male Brown-Norway (BN) rats is 31.4+/-1.2% (dry weight), whereas that of male LOU rats is 37.2+/-1.0%. A similar difference in the elastin content of the thoracic aorta is also observed in female animals. Furthermore, in the thoracic aorta of young, growing rats as well as in cultured aortic smooth muscle cells, the steady-state level of elastin mRNA is significantly lower in the BN than in the LOU strain. These results suggested that 1 or more genes control the elastin mRNA level and the elastin content in the aortas of BN and LOU rats. A possible relationship between a polymorphism in the elastin gene and the elastin content of the aorta was tested. For this purpose, the aortic elastin content was measured in F(1) and F(2) generations bred from LOU and BN rats and was compared with that of the F(0) (parental) generation. A polymorphic marker located in intron 25 of the elastin gene has been used to genotype the F(2) rats. The degree of genetic determination of aortic elastin content was estimated to be 73% in the F(2) cohort, but the elastin locus accounts for only 3. 9% of the total variance in aortic elastin content. Other genes are thus responsible for the major part of the observed interstrain difference by regulating the transcription of the gene, the stability of elastin mRNA, and/or posttranslational events.

Alleles↗

Aluminum chloride pretreatment of elastin inhibits elastolysis by matrix metalloproteinases and leads to inhibition of elastin-oriented calcification.

Calcification of elastin occurs in many pathological cardiovascular diseases including atherosclerosis. We have previously shown that purified elastin when subdermally implanted in rats undergoes severe calcification and aluminum chloride (AlCl(3)) pretreatment of elastin inhibits calcification. In the present study we investigated whether matrix metalloproteinase (MMP) binding to elastin and elastin degradation is prevented by AlCl(3) pretreatment. Subdermal implantation of AlCl(3)-pretreated elastin showed significantly lower MMP-9 and MMP-2 activity surrounding the implant as compared to the control implants. AlCl(3) pretreatment also significantly inhibited elastin implant calcification at the seven-day implant period (AlCl(3)-pretreated 4.07 +/- 1.27, control 23.82 +/- 2.24 microg/mg; p<0.0001). Moreover, elastin gel zymography studies showed that gel pretreatment with AlCl(3) inhibited elastolysis by MMP-9. We also demonstrate significant suppression of MMP-2 activity in aortic wall segments of AlCl(3)-pretreated porcine bioprosthetic heart valve implants as compared to control valve implants in sheep mitral valve replacement studies. AlCl(3) pretreatment also significantly inhibited calcification of elastin in this model. Thus, we conclude that aluminum ion binding to elastin prevents MMP-mediated elastolysis and thus prevents elastin calcification.

Aluminum Chloride↗

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability.

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.

3' Untranslated Regions↗

Increased elastin content and decreased elastin concentration may be predisposing factors in dissecting aneurysms of human thoracic aorta.

OBJECTIVE: The aim was to investigate whether changes in elastin distribution in the thoracic aorta are associated with occurrence of dissecting aneurysms. METHODS: Ten thoracic aortas were obtained at necropsy from dissections (mean patient age 74.3 years, SD 7.3) and from 10 age matched controls (mean age 73.1 years, SD 6.9). Full wall thickness samples (1 cm diameter) were taken at 12 sites between heart and diaphragm from aortas of dissections and controls. Elastin content (total elastin per sample), concentration (mg.mg-1 tissue dry weight), degree of cross linking, and amino acid composition were determined. RESULTS: Comparison of areas of dissected aortas involved in dissection with corresponding areas of controls showed significant increases in content of elastin (p < 0.05), content and concentration of proteins other than elastin and collagen (p < 0.01), and a decrease in elastin concentration (p < 0.01). Comparison of areas remote from dissection with corresponding areas in controls showed no significant differences except for decreased elastin concentration (p < 0.05). There were no differences in elastin cross linking. Elastin from dissected aortas had a higher content of aspartate, threonine, serine, glutamate, and lysine and a lower content of glycine, alanine, and valine than elastin from controls (p < 0.05). CONCLUSIONS: Biochemical changes in dissections are localised to the dissected area, with increased deposition of elastin, collagen, and other proteins. The altered matrix composition is likely to change the mechanical properties, possibly increasing the tendency to rupture.

Aged↗

Pharmacological studies on elastin peptides (kappa-elastin). Blood clearance, percutaneous penetration and tissue distribution.

Soluble elastin peptides obtained by partial hydrolysis of ligamentum nuchae elastin in 1M KOH in 80 per cent aqueous ethanol (kappa-elastin) were labelled in vitro by incubation with tritiated borohydrate. 3H-labelled kappa-elastin was administered iv and percutaneously and its elimination and organ distribution determined. iv administered kappa-elastin is rapidly eliminated through the kidneys with a first rapid phase (t 1/2 9.9 min) and a second slower phase (t 1/2 169 min). Percutaneously administered elastin peptides penetrate in the dermis and 30 to 40 per cent of the administered label can still be found in the skin 48 hours later. Resorption through the skin is a slow process, with very little or no radioactivity detectable at any time in the blood. Only liver and lung contained significant amounts of radioactivity (4 per cent and 2 per cent of the total dose administered) at 48 hours after administration. Urinary elimination represented about 5 per cent of the administered dose. Histochemical studies performed on the skin of rats treated daily with kappa-elastin (25 mg per day for 4 weeks) showed an increase of elastin-staining material in the dermis. This increase is partly due to a modified staining of collagen bundles, resulting probably from the association of elastin peptides with the collagen bundles. It may also partly be due to an increase of elastin fibers in the dermis through the stimulation of fibroblast activity. These histochemical results confirm the penetration of elastin peptides in the dermis, their association with dermal collagen fibers and also their action on the cellular activity of the dermis.

Administration, Topical↗

Vascular smooth muscle cell detachment from elastin and migration through elastic laminae is promoted by chondroitin sulfate-induced "shedding" of the 67-kDa cell surface elastin binding protein.

Impaired elastin fiber assembly is observed in the fetal ductus arteriosus (DA), associated with a reduced concentration of elastin binding protein (EBP), a 67-kDa galactolectin. It is also seen in cultured aortic (Ao) smooth muscle cells (SMC) following the release of the EBP by glycosaminoglycans rich in N-acetylgalactosamine, such as chondroitin sulfate (CS). In the DA, impaired elastin fiber assembly is observed in conjunction with intimal thickening associated with increased migration of SMC into the subendothelium, a feature we previously related to increased production of fibronectin. In this report, we determined whether SMC use the EBP to attach to an elastin substrate, whether shedding of the EBP promotes SMC migration through a three-dimensional network of pure elastic laminae prepared from sheep aorta, and whether the latter is associated with increased production of fibronectin. We observed reduced attachment to elastin-coated surfaces of DA SMC deficient in EBP compared to Ao SMC. Addition of CS but not heparan sulfate (a glycosaminoglycan which does not induce EBP shedding) decreased Ao SMC attachment to elastin, as did preincubation with VGVAPG elastin-derived peptides which saturate the EBP. The immunolocalization of cell surface EBP suggested that cells can quickly replace EBP released from their surfaces by CS treatment. The magnitude of CS-induced impaired attachment of SMC to elastin was dose dependent and could be further increased by the administration of cyclohexamide and sodium azide. Also, the reversibility of CS-induced detachment was prevented by monensin. This suggests that a process of new synthesis and intracellular transport of the EBP was necessary to replace the EBP molecules released from the cell surface by CS treatment. In the migration assay, both DA and Ao SMC attached to the top of an elastin membrane, but only DA SMC deficient in EBP migrated through the laminae. Addition of CS, which induced shedding of EBP, resulted in Ao SMC migration associated with increased synthesis of fibronectin. We postulate that CS-induced release of EBP from SMC surfaces causes cell detachment from elastin and an increase in fibronectin synthesis, processes which may be critical in promoting SMC migration associated with intimal thickening developmentally in the DA and perhaps also in vascular disease.

Amino Acid Sequence↗

Elastin--lipid interaction action in the arterial wall. Part 1. Extraction of elastin from human aortic intima.

Elastin was extracted from human aortic plaque and adjacent grossly normal intima by the following methods: (1) 0.1 N NaOH at 100 degrees C, (2) hot NaOH and 0.2 M EDTA, (3) 5 M guanidine--HCl and collagenase, (4) guanidine--collagenase and dithioerythritol--urea--sodium dodecyl sulfate, (5) guanidine--collagenase and EDTA, (6) 10% NaCl and collagenase, and (7) NaCl--collagenase and EDTA. All elastin samples contained small amounts of carbohydrate and hydroxyproline. The lipid content of non-plaque intimal elastin samples was small (2--3%), whereas it increased to 4--6% in plaque intima. The lipid composition of elastin preparations varied significantly with the extraction procedure. Elastin from plaque intima contained significantly more cholesterol (50--60%) and less triglyceride and phospholipid than elastin of non-plaque intima (30--50% cholesterol). The contents of free and esterified cholesterol were comparable in all preparations. The main phospholipid in all samples was sphingomyelin, which comprised between 50 and 80% of the total phospholipid. Compared with NaOH-purified elastin, the other elastin samples were characterized by an increased phosphatidyl--choline content, while they all contained an almost equal amount of phosphatidylethanolamine. In elastin samples from plaque intima, the polar amino acids were increased, whereas cross-linking amino acids were decreased. The polarity and hydroxyproline content of elastin samples were slightly decreased after treatment with EDTA or dithioerythritol--urea--sodium dodecyl sulfate.

Amino Acids↗

Two new elastin cross-links having pyridine skeleton. Implication of ammonia in elastin cross-linking in vivo.

Isolation and structure analysis of two amino acids from bovine ligamentum nuchae elastin hydrolysates revealed the presence of pyridine cross-links in elastin. The structures of these amino acids were determined to have 3,4,5- and 2,3,5-trisubstituted pyridine skeletons both with three carboxylic acids and a mass of 396 (C(18)H(28)N(4)0(6)) identified as 4-(4-amino-4-carboxybutyl)-3,5-di-(3-amino-3-carboxypropyl)-pyridine and 2-(4-amino-4-carboxybutyl)-3,5-di-(3-amino-3-carboxypropyl)-pyridine. We have named these pyridine cross-links desmopyridine (DESP) and isodesmopyridine (IDP), respectively. Structure analysis of these pyridine cross-links implied that the formation of these cross-links involved the condensation reaction between ammonia and allysine. The elastin incubated with ammonium chloride showed that DESP and IDP levels increased as the allysine content decreased. DESP and IDP were measured by high pressure liquid chromatography (HPLC) with UV detection and were found in a variety of bovine tissues. The DESP/desmosine (DES) and IDP/isodesmosine (IDE) ratios in aorta elastin were higher than in other tissues. DESP and IDP contents in human aorta elastin were found to be gradually increased with age. The concentration of IDP was significantly elevated in aorta elastin of rat with chronic liver cirrhosis induced by carbon tetrachloride (mean +/- S.D.; 11.1 +/- 0.9 nmol/mg elastin) when compared with normal rats (5.9 +/- 1.5 nmol/mg elastin). Although DESP and IDP are present at only trace concentrations in the tissue elastin, these pyridine cross-links may be useful biomarkers for the aortic elastin damaged by ammonia.

2-Aminoadipic Acid↗

Appearance of chemotactic responsiveness to elastin peptides by developing fetal bovine ligament fibroblasts parallels the onset of elastin production.

We studied chemotaxis to elastin peptides by bovine ligamentum nuchae fibroblasts to determine whether there is a developmental association between chemotactic responsiveness to elastin and expression of the elastin phenotype. Undifferentiated ligament cells demonstrate chemotactic responsiveness to platelet-derived growth factor and fibronectin, known chemoattractants for fibroblasts, but do not show chemotaxis to elastin peptides. After matrix-induced differentiation, however, young cells display a positive chemotactic response to elastin that persists even after the cells are removed from the matrix substratum. Matrix-induced chemotaxis to elastin could be inhibited selectively by incorporation of bromodeoxyuridine into DNA of undifferentiated cells before (but not after) contact with inducing matrix. These results show that the appearance of chemotaxis to elastin peptides parallels the onset of elastin synthesis and suggests that the acquisition of chemotactic responsiveness to elastin and expression of the elastin phenotype are affected by the same inducing elements or processes and may be closely coupled in development.

Animals↗