PubMed HealthSearch

SEARCH · PubMed Health

Results for “Genes, Reporter”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

Screening of Estrogenic and Antiestrogenic Effects of Estradiol, Bisphenol A, and Fulvestrant Using 2D and 3D Breast Cancer Cell Systems With a Luciferase Reporter Gene Assay.

Endocrine-disrupting chemicals (EDCs) like bisphenol A (BPA) pose health risks by interfering with hormones. This study develops and utilizes in vitro 2D and 3D cell models to evaluate the estrogenic and antiestrogenic properties of compounds. Human breast cancer cell lines T47D and MCF7, stably transfected with a luciferase reporter gene (ERE-LUC), were first compared in 2D. Due to the significantly higher sensitivity and responsiveness observed in the T47D line during preliminary 2D screenings, this cell line was exclusively selected for the development of the 3D spheroid model. Cells were treated with 17β-estradiol (E2), BPA, and Fulvestrant (FUL) to assess cell viability and luciferase activity. In 2D models, T47D ERE-LUC cells showed higher responsiveness than MCF7 ERE-LUC, which failed to show significant luciferase induction with E2. In the 3D T47D model, cells exhibited significant and robust changes in luciferase activity in response to E2 and BPA, highlighting the enhanced fidelity of 3D cultures in replicating tissue conditions compared to their 2D counterparts. The study highlights the effectiveness of 3D models over 2D in evaluating estrogenic activity. Specifically, the 3D T47D ERE-LUC system serves as a superior, sensitive, and reliable platform for screening EDCs, offering benefits in cost, data speed, and reduced in vivo reliance.

Humans

Cloning, Transformation, and Reporter Gene Analysis of the SalT Promoter in Barley (Hordeum vulgare).

Constitutive gene expression can lead to pleiotropic effects. Therefore, spatial or temporal restriction of expression via specific promoters provides a more targeted approach. This study aimed to clone the SalT promoter and analyze its activity in transgenic barley using GFP and GUS reporter genes. The T-DNA constructs carrying the SalT promoter were introduced into barley cv. Golden Promise, and transgenic plants were confirmed through PCR, hygromycin selection, and Southern hybridization. Both constructs, SalT-GFP and SalT-GUS, were transformed in barley cv. Golden Promise. Here, we characterized the expression pattern of the SalT promoter in barley and utilized it to drive the expression of reporter genes GFP and GUS. The SalT promoter was isolated from rice genomic DNA, cloned into the pNos-AB-M vector, and confirmed through PCR and restriction analysis. Subsequently, GFP and GUS genes were cloned under the SalT promoter in the same vector. The constructs were then subcloned into the p6U vector for plant expression. Agrobacterium-mediated genetic transformation of barley cultivar "Golden Promise" was conducted, resulting in successful integration of the transgenes. Callus induction, regeneration, and root formation efficiency were assessed, demonstrating the potential of the SalT promoter to drive gene expression during various stages of plant development. Molecular analyses, including PCR and Southern hybridization, confirmed the presence and integration of transgenes in the barley genome. Furthermore, GFP fluorescence and GUS staining analyses revealed strong expression of the respective genes under control of the SalT promoter in different plant tissues. This study provides insights into the application of the SalT promoter for genetic manipulation and functional characterization in barley, offering opportunities for crop improvement and biotechnological applications.

Hordeum

Development of an Efficient Regeneration and Agrobacterium-Mediated Transformation Protocol for Hosta 'Light Star' Using the RUBY Reporter Gene.

Hosta plantaginea is a perennial shade-tolerant herb of the Liliaceae family, with high ornamental and urban greening value. Hosta 'Light Star' is a newly developed ornamental cultivar with yellow-margined leaves and lilac flowers, but no efficient in vitro regeneration or genetic transformation system has been established for this cultivar to date. In this study, we established a highly efficient in vitro regeneration system for Hosta 'Light Star,' and developed an Agrobacterium-mediated genetic transformation protocol using the RUBY visual reporter gene for non-invasive screening of positive transformants. The optimal callus induction medium was MS&#x2009;+&#x2009;2&#xa0;mg/L 6-BA&#x2009;+&#x2009;0.3&#xa0;mg/L NAA&#x2009;+&#x2009;0.05&#xa0;mg/L 2, 4-D, with a callus induction rate of 53.33% for leaf explants (the optimal explant for sterile seedlings). The optimal adventitious bud proliferation medium was MS&#x2009;+&#x2009;2&#xa0;mg/L 6-BA&#x2009;+&#x2009;0.1&#xa0;mg/L NAA, with a proliferation coefficient of 5.87. The optimal rooting medium was 1/2 MS&#x2009;+&#x2009;0.5&#xa0;mg/L NAA&#x2009;+&#x2009;0.5&#xa0;mg/L IBA, with a 100% rooting rate. The optimal transplant substrate was perlite:vermiculite&#x2009;=&#x2009;2:1, with a 100% transplant survival rate after acclimatization. For Agrobacterium-mediated transformation, the optimal infection parameters were as follows: Agrobacterium suspension OD600&#x2009;=&#x2009;0.6, infection time of 10&#xa0;min, and 200&#xa0;&#x3bc;M acetosyringone; the optimal selection conditions were 300&#xa0;mg/L cefotaxime for bacteriostasis and 30&#xa0;mg/L hygromycin for transformant screening. The final stable transformation efficiency was 2.50% (95% CI 1.23-3.77%), with an escape rate of 16.13%. Transgenic plants showed distinct purplish-red coloration in roots, stems, and leaves, with significantly higher betacyanin accumulation than wild-type plants (p&#x2009;<&#x2009;0.05). Stable integration and expression of the RUBY gene were confirmed by PCR, RT-PCR, and RT-qPCR. This study establishes the first efficient regeneration and Agrobacterium-mediated transformation system for Hosta 'Light Star,' and validates the feasibility of the RUBY reporter gene as a visual marker for Hosta transformation. This system provides a solid technical platform for functional genomic studies, CRISPR/Cas9-mediated gene editing, and molecular breeding of ornamental traits in Hosta.

Transformation, Genetic

Reporter Gene Assays to Measure FOXO-Specific Transcriptional Activity.

The forkhead box O (FOXO) family of transcription factors translates environmental cues into precise gene expression patterns maintaining cellular equilibrium while influencing critical determinations of cell destiny and differentiation. FOXO proteins exert their effects through specific consensus binding to promoter sites within target genes. Notably, among the array of techniques available for assessing the transcriptional activity of FOXO factors, the utilization of luciferase-based reporters emerges as particularly distinctive. Luciferase, an enzyme sourced from bioluminescent organisms, instigates the oxidation of luciferin, culminating in the generation of oxyluciferin accompanied by discernible luminescence, a quantifiable event readily gauged using a luminometer. The adoption of luciferase activity as a measure in transcriptional assays is widespread due to its numerous advantages including simplicity, remarkable reproducibility, and high sensitivity. Moreover, the continuous advancements witnessed in luciferase-based vectors and measurement reagents bestow notable flexibility upon this methodology. Luciferase-based reporters offer a powerful tool for uncovering constituents within the signaling pathways governing FOXO factor function. Furthermore, these assays are also suitable for evaluating the efficacy of FOXO-targeting agents, whether they be inhibitors or activators. Here, we present a comprehensive, step-by-step elucidation of a commonly employed assay, adeptly quantifying the potential of small molecular compounds to amplify FOXO-specific transcriptional activity in U2OS cells.

Genes, Reporter

Congenital myasthenic syndrome secondary to pathogenic variants in the SLC5A7 gene: report of two cases.

BACKGROUND: Congenital Myasthenic Syndromes (CMS) are rare genetic diseases, which share as a common denominator muscle fatigability due to failure of neuromuscular transmission. A distinctive clinical feature of presynaptic CMS variants caused by defects of the synthesis of acetylcholine is the association with life-threatening episodes of apnea. One of these variants is caused by mutations in the SLC5A7 gene, which encodes the sodium-dependent HC-3 high-affinity choline transporter 1 (CHT1). To our knowledge there are no published cases of this CMS type in Latin America. CASE PRESENTATION: We present two cases of CHT1-CMS. Both patients were males presenting with repeated episodes of apnea, hypotonia, weakness, ptosis, mild ophthalmoparesis, and bulbar deficit. The first case also presented one isolated seizure, while the second case showed global developmental delay. Both cases, exhibited incomplete improvement with treatment with pyridostigmine. CONCLUSIONS: This report emphasizes the broad incidence of CMS with episodic apnea caused by mutations in the SLC5A7 gene and the frequent association of this condition with serious manifestations of central nervous system involvement.

Humans

Emerging genes implicated in human congenital heart disease: a 2023-2025 scoping review.

BACKGROUND: Congenital heart disease (CHD) is the most common major congenital anomaly and a leading cause of infant morbidity and mortality. The rapid expansion of genomic technologies has accelerated the discovery of rare genetic variants implicated in CHD pathogenesis. However, most individuals with CHD still lack an identifiable molecular etiology. The purpose of this scoping review is to systematically characterize genes reported in the recent literature as candidate CHD-associated genes and contextualize these findings within the stages of cardiac morphogenesis. METHODS: PubMed was searched using predefined terms related to CHD and genetic variants, supplemented by a prospectively maintained internal database. We included human studies published between January 2023 and December 2025 that identified pathogenic, likely pathogenic, or uncertain monogenic variants in at least one patient with CHD. Animal-only studies, chromosomal abnormalities, copy number variants, multigenic associations, transcriptomic/proteomic analyses, reviews, and maternal-only genetic studies were excluded. Gene-disease validity classifications were assigned using the Clinical Genome Resource (ClinGen) CHD Gene Curation Expert Panel framework. RESULTS: Of 2,834 screened articles, 391 studies met inclusion criteria, identifying 912 unique genes reported as candidate CHD-associated genes. Frequently reported genes included PTPN11, NOTCH1, GATA4, JAG1, MYH6, GATA6, and LZTR1. Identified genes spanned all major stages of cardiogenesis, including developmental priming, cardiac progenitor specification, left-right axis formation, neural crest migration, outflow tract development, septation, and postnatal structural remodeling. Studies increasingly implicated ciliary dysfunction, transcriptional regulation, ribosomal biology, and multigenic inheritance in CHD pathogenesis. Emerging methodologies included stem cell-derived cardiac models, machine learning-based gene prioritization, and epigenetic analyses. CONCLUSIONS: Recent literature substantially expands the catalog of candidate genes that may be associated with CHD and highlights the biologic complexity underlying cardiac morphogenesis. Integration of genomic, developmental, and functional approaches will be essential to improve mechanistic understanding, refine genetic counseling, and support future precision medicine strategies for CHD.

Cardiac development

A Dual-Selection System for Enhanced Efficiency and Fidelity of Circular RNA Overexpression.

Circular RNAs (circRNAs) are essential regulators of cellular processes, but are challenging to study using traditional methods. Overexpression approaches, such as the use of linearized plasmids and viral vectors, often result in high rates of false-positive clones, where cells retain selection markers without expressing the target circRNA. This study addresses this limitation by developing a dual-selection circRNA system designed to enhance the accuracy and reliability of circRNA overexpression. Our system integrates a fluorescent reporter gene upstream of the circRNA expression cassette, under a shared promoter, and a downstream antibiotic resistance marker, allowing for both antibiotic selection and flow cytometric cell-sorting to identify and enrich cells with genuine circRNA expression. We successfully incorporated this system into an inducible lentiviral vector for controlled overexpression in various cell types. The dual-selection circRNA system offers a significant advance for circRNA research and studies of other RNA species where accurate and reliable overexpression is essential.

RNA, Circular

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals

Dual-Reporter Gene-Based Multimodal Imaging for Tracking Mesenchymal Stem Cells in Diabetic Skin Wound Repair.

BACKGROUND: Diabetic foot ulcer (DFU) is a clinically challenging complication characterized by poor healing outcomes, and conventional therapies provide limited benefit. Mesenchymal stem cell (MSC) transplantation offers a promising strategy for DFU repair. However, the low survival of transplanted MSCs in the hostile wound microenvironment, coupled with the lack of real-time, non-invasive methods to track these cells in vivo, severely hampers their therapeutic efficacy and clinical translation. METHODS: We engineered MSCs to co-express a dual reporter system comprising near-infrared fluorescent protein (iRFP) and ferritin heavy chain (FTH1). These modified cells were then integrated with a fibrin glue (FG) scaffold to create a unified platform that supports both multimodal imaging and therapeutic function within skin wounds. First, FTH1 overexpression enhances the antioxidant capacity of MSCs, while the FG scaffold provides structural support; this combination enhances cell survival and retention. Second, the iRFP/FTH1 dual reporter enables near-infrared fluorescence imaging and MRI-based localization, establishing a multimodal platform for real-time cell tracking. RESULTS: In a full-thickness skin defect model in diabetic mice, multimodal imaging revealed that transplanted cells persisted in the wound area for approximately seven days. Treatment with iRFP/FTH1-MSCs/FG significantly accelerated wound closure and promoted hair follicle regeneration and angiogenesis. Additionally, local iron deposition resulting from FTH1 expression enhanced fibroblast migration and collagen synthesis, further facilitating extracellular matrix remodeling. Mechanistic studies demonstrated that this therapy drives macrophage polarization toward the anti-inflammatory M2 phenotype and activates the PI3K-AKT-VEGF signaling pathway. These complementary effects synergistically enhance tissue regeneration and systematically improve diabetic wound healing. CONCLUSIONS: Collectively, this multimodal stem cell-scaffold system effectively integrates dynamic cell tracking with stem cell therapy during skin wound repair. It addresses a critical technical gap in visualizing stem cells within the wound microenvironment and provides valuable methodological and theoretical foundations for optimizing regenerative strategies for diabetic skin wounds.

Animals

Evaluation of Vaccinia Virus Infection in Mice Using Two-Reporter Recombinant Virus.

The family Poxviridae comprises multiple viruses with large double-stranded (ds) DNA genomes that can infect numerous vertebrate and invertebrate hosts, including humans. The development of genetic engineering methods for Vaccinia virus (VACV), the prototypic member in the family, have allowed the manipulation of the genomes of poxviruses for the generation of recombinant (r)VACV expressing easily traceable luciferase and/or fluorescent reporter genes. These recombinant viruses have significantly contributed to progress in the field of poxvirus research and accelerated the development of novel prophylactic vaccines and therapeutic antiviral treatments. Recently, we described two reporter rVACV expressing luciferase (Nluc) and fluorescent (GFP or Scarlet) proteins to easily track viral infections in different systems, overcoming the limitations associated with the use of rVACV expressing a single luciferase or fluorescent reporter gene. Here, we describe the experimental procedures to carry out in vitro, in vivo and ex vivo studies using these novel bireporter-expressing rVACV, which also represent an excellent option to study the biology of VACV, including the use of these reporter viruses for testing new antivirals and vaccines, using cultured cells and/or well-characterized animal models of infection.

Animals

Novel photoreceptor-specific promoters for gene therapy in mid- to late-stage retinal degeneration.

Inherited retinal degenerations (IRDs) cause progressive photoreceptor loss, leading to vision impairment. Gene therapy using adeno-associated viral (AAV) vectors holds immense promise for treating these conditions. However, achieving optimal gene expression at mid to late stages of retinal degeneration remains challenging due to scarcity of efficient photoreceptor-specific promoters expressed at these disease stages. This study aimed to identify and validate novel promoters capable of robust and specific transgene expression when &#x2265;50% of photoreceptors are lost. Analysis of transcriptomic data from two naturally occurring canine IRD models, laser capture microdissection of retinal cryosections followed by qPCR, and RNA in situ hybridization identified six promising genes with sustained or upregulated expression in photoreceptors in late-stage disease. Upstream cis-regulatory elements of both canine and human orthologs were identified and characterized using in silico analyses and dual-luciferase assays. Short promoters (&#x2264;840 base pairs) derived from GNGT2, IMPG2, and PDE6H genes exhibited robust reporter gene expression in photoreceptors when delivered via AAV to the subretinal space of two non-allelic canine IRD models at mid and late disease stages. These findings provide a strategy to enhance AAV-mediated gene therapy by enabling sustained transgene expression in degenerating retinas, improving treatment outcomes for patients with progressive vision loss.

Retinal Degeneration

Marburg Virus Minigenome Assays.

This chapter describes minigenome systems for Marburg virus (MARV), which reconstitute the viral polymerase complex functions of gene expression and genome replication. Procedures covered herein include passage and seeding of cells, transfection, sample collection, and reporter gene assays.

Marburgvirus

Rapid Generation of Reverse Genetics Systems for Coronavirus Research and High-Throughput Antiviral Screening Using Gibson DNA Assembly.

Coronaviruses (CoVs) pose a significant threat to human health, as demonstrated by the COVID-19 pandemic. The large size of the CoV genome (around 30&#x2009;kb) represents a major obstacle to the development of reverse genetics systems, which are invaluable for basic research and antiviral drug screening. In this study, we established a rapid and convenient method for generating reverse genetic systems for various CoVs using a bacterial artificial chromosome (BAC) vector and Gibson DNA assembly. Using this system, we constructed infectious cDNA clones of coronaviruses from three genera: human coronavirus 229E (HCoV-229E) of the genus Alphacoronavirus, mouse hepatitis virus A59 (MHV-59) of Betacoronavirus, and porcine deltacoronavirus (PDCoV-Haiti) of Deltacoronavirus. Since beta coronaviruses including severe acute respiratory syndrome coronavirus (SARS-CoV), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and Middle East respiratory syndrome coronavirus (MERS-CoV) represent major human pathogens, we modified the infectious clone of the beta coronavirus MHV-A59 by replacing its NS5a gene with a fluorescent reporter gene to create a system suitable for high-throughput drug screening. Thus, this study provides a practical and cost-effective approach to developing reverse genetics platforms for CoV research and antiviral drug screening.

Reverse Genetics

Hepatocyte growth factor-activated NF-kappaB regulates HIF-1 activity and ODC expression, implicated in survival, differently in different carcinoma cell lines.

Hepatocyte growth factor (HGF)-stimulated Met signaling influences tumor survival, growth and progression, all processes involving the transcription factor NF-kappaB. NF-kappaB plays a complex role in the control of survival due to the influence of cellular factors acting downstream. We undertook a comparative investigation of two human breast carcinoma cells with different grades of malignancy and HepG2 hepatoma cells, which present a biphasic response to HGF (proliferation followed by apoptosis). We found evidence that HGF induced gene patterns characteristic of survival rather than apoptosis depending on the cell type. The ability of NF-kappaB to regulate expression of hypoxia-inducible factor-1alpha (HIF-1alpha), a survival/anti-apoptotic gene in cancer, seemed to be critical. In the HepG2 and MCF-7 (low invasive breast carcinoma) cell lines increased transcription and translation were responsible for HIF-1alpha induction after HGF. The regulation by NF-kappaB was mainly at the level of the 5'-UTR of the HIF-1alpha message. HIF-1 (alpha/beta heterodimer) was likely to transactivate Mcl-1, another anti-apoptotic gene. Opposite results were observed in MDA-MB-231 cells (highly invasive breast carcinoma), which have high NF-kappaB activity, further inducible by HGF, because HIF-1alpha mRNA expression and HIF-1 transactivating capacity were HGF-insensitive while the alpha subunit seemed to be degraded after HGF. However, ornithine decarboxylase (ODC) and heme oxygenase mRNA expression persistently increased. By transiently transfecting two ODC gene reporters we demonstrated that ODC is a target gene of NF-kappaB in HGF-treated tumor cells. By regulating HIF-1 activity and specific gene expression downstream, NF-kappaB may influence the survival threshold, with an impact on the fate of carcinoma cells after prolonged HGF treatment.

Breast Neoplasms

Generation of Biologically Contained Marburg Virus.

Wild-type Marburg virus (MARV) can only be handled in biosafety level 4 facilities. By removing an essential gene from the virus genome, deficient virus particles can be generated that are only capable of replication if the missing gene product is provided in trans. As a result, these viruses are restricted to specific cell lines, making them safe to handle at lower biosafety levels. Here, we provide a detailed overview of how to generate MARV in which the VP30 gene has been replaced by a green fluorescent reporter gene, as well as how to use lentiviral transduction to create stable cell lines expressing MARV VP30. These cell lines can be used for the propagation and confinement of the resulting reporter virus.

Marburgvirus

Identification of gene targets regulated by the IclR-like regulator SL1344_3500 in Salmonella Typhimurium.

Transcriptional regulation of metabolic operons is important for optimal carbohydrate use and for mitigating the accumulation of toxic intermediates. Here, we characterize SL1344_3500, encoding a putative IclR-like regulator in Salmonella enterica Typhimurium. We present genetic and transcriptional evidence that it regulates the expression of two neighboring operons, one designated here as xynABC, enables utilization of xylonate as a sole carbon source. Furthermore, our findings indicate that SL1344_3500 is important for luminal growth in several mouse models, exerting its effects through the suppression of the xynABC operon. Based on the observation that the &#x394;SL1344_3500 deletion can be stably complemented in vivo, we developed a plasmid stabilization strategy. This gene complementation approach shows promise for generating stable gene reporters for long-term colonization experiments.IMPORTANCEUnderstanding transcriptional regulation in Salmonella enterica Typhimurium is crucial for revealing how enteric pathogens optimize metabolism to compete with commensals in the gut. SL1344_3500, an IclR-like transcriptional regulator controlling genes linked to sugar acid metabolism, is essential for luminal growth in mouse models through gene suppression and represents a potential target for antimicrobial development. Based on these observations, we developed stable reporter plasmids that use gene complementation of SL1344_3500 to prevent plasmid loss during long-term in vivo studies.

Salmonella typhimurium

Evaluating selection at intermediate scales within genes provides robust identification of genes under positive selection in M. tuberculosis clinical isolates.

Multiple studies have reported genes in the M. tuberculosis (Mtb) genome that are under diversifying selection, based on genetic variants among Mtb clinical isolates. These might reflect adaptions to selection pressures associated with modern clinical treatment of TB. Many, but not all, of these genes under selection are related to drug resistance. Most of these studies have evaluated selection at the gene-level. However, positive selection can be evaluated on different scales, including individual sites (codons) and local regions within an ORF. In this paper, we use GenomegaMap, a Bayesian method for calculating selection, to evaluate selection of genes in the Mtb genome at all three levels. We present evidence that the intermediate analysis (windows of codons) yields the most credible list of candidate genes under selection (excluding PPE and PE_PGRS genes, which are predicted less reliably due to frequent sequencing errors). A further advantage of this approach is that it identifies specific regions within proteins that are under selective pressure, which is useful for structural and functional interpretation. In an analysis of two separate collections of Mtb clinical isolates (from Moldova; and a globally-representative set), we observed 53 and 173 significant genes under selection, with 36% overlap. The lists of genes under selection include many drug-resistance genes, as well as other genes that have previously been reported to be under selection (resR, phoR). The specific regions under selection identified within drug-resistance genes are shown to correspond to protein structural features known to be involved in resistance, supporting accuracy of the method. Positive selection in several ESX-1-related genes was also observed, suggesting adaptation to immune pressure.

adaptation

Enhancing the utility of adeno-associated virus gene transfer through inducible tissue-specific expression.

The ability to regulate both the timing and specificity of gene expression mediated by viral vectors will be important in maximizing its utility. We describe the development of an adeno-associated virus (AAV)-based vector with tissue-specific gene regulation, using the ARGENT dimerizer-inducible system. This two-vector system based on AAV serotype 9 consists of one vector encoding a combination of reporter genes from which expression is directed by a ubiquitous, inducible promoter and a second vector encoding transcription factor domains under the control of either a heart- or liver-specific promoter, which are activated with a small molecule. Administration of the vectors via either systemic or intrapericardial injection demonstrated that the vector system is capable of mediating gene expression that is tissue specific, regulatable, and reproducible over induction cycles. Somatic gene transfer in vivo is being considered in therapeutic applications, although its most substantial value will be in basic applications such as target validation and development of animal models.

Animals