SEARCH · PubMed Health

Results for “Heterogeneous Nuclear Ribonucleoprotein A1”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed1996

Origins of binding specificity of the A1 heterogeneous nuclear ribonucleoprotein.

The A1 heterogeneous nuclear ribonucleoprotein (hnRNP) is the best studied of the "core" hnRNP proteins that are tightly associated with heterogeneous nuclear RNA (hnRNA) within eukaryotic nuclei. Previous studies suggested that hnRNP A1 preferentially binds (under nonequilibrium conditions) to the pyrimidine-rich span of sequence at the 3'splice site of most introns [Swanson, M.S., & Dreyfuss, G. (1988) EMBO J. 11, 3519-3529; Buvoli et al. (1990) Nucleic Acids Res. 18, 6595-6600; Ishikawa et al. (1993) Mol. Cell. Biol. 13, 4301-4310]. Recently, Burd and Dreyfuss [(1994) EMBO J. 13, 1197-1204] used selection/amplification from pools of random sequence RNA to uncover an even higher-affinity A1 oligo that contained two copies of a high-affinity consensus sequence, UAGGGU/A. We have extended these studies by using a fluorescence assay to characterize the equilibrium binding properties of A1 to each of these oligonucleotides. By also characterizing the binding of A1 to sequence-randomized control oligonucleotides, we have been able to better evaluate the inherent "sequence-specific" binding properties of A1. Although these studies indicate that under equilibrium conditions A1 cannot specifically recognize the beta-globin, 3'-splice site DNA oligo analogue studied by Buvoli et al. (1990), they confirmed the high-affinity binding to the "winner" 20-mer RNA that was uncovered via selection/amplification and that has the sequence UAUGAUAGGGACUUAGGGUG (Burd & Dreyfuss, 1994). In 0.1 M NaCl, we found that A1 has approximately 100-fold higher affinity for this winner sequence sequence than it does for either a randomized version of this sequence or a 20-mer oligo corresponding to an unrelated beta-globin intron sequence. This winner RNA oligo aggregates in solution to form an apparent dimer that may represent a G-quartet resulting from dimerization of two Hoogsteen base-paired hairpins. On the basis of salt sensitivity studies carried out with various fragments of A1, the ability of A1 to discriminate the winner sequence from its randomized control results primarily from increased ionic interactions with the glycine-rich, COOH terminal domain of A1 that extends from residue 196 to 319. Nonetheless, most of the overall energy of binding for the A1 winner complex results from determinants that are resident within the first 195 residues of A1. The unique ability of the winner sequence (but not its sequence-randomized control) to form a higher-order aggregate, which may correspond to a G-tetrad, appears to facilitate the additional ionic interactions with the COOH terminal domain. Taken together, these data suggest the need to reevaluate possible and probable functions of A1 in vivo.

Amino Acid Sequence↗

PubMed1997

Sequence-specific binding protein of single-stranded and unimolecular quadruplex telomeric DNA from rat hepatocytes.

A rat liver nuclear protein, unimolecular quadruplex telomere-binding protein 25, (uqTBP25) is described that binds tightly and specifically single-stranded and unimolecular tetraplex forms of the vertebrate telomeric DNA sequence 5'-d(TTAGGG)n-3'. A near homogeneous uqTBP25 was purified by ammonium sulfate precipitation, chromatographic separation from other DNA binding proteins, and three steps of column chromatography. SDS-polyacrylamide gel electrophoresis and Superdex copyright 200 gel filtration disclosed for uqTBP25 subunit and native Mr values of 25.4 +/- 0.5 and 25.0 kDa, respectively. Sequences of uqTBP25 tryptic peptides were closely homologous, but not identical, to heterogeneous nuclear ribonucleoprotein A1, heterogeneous nuclear ribonucleoprotein A2/B1, and single-stranded DNA-binding proteins UP1 and HDP-1. Complexes of uqTBP25 with single-stranded or unimolecular quadruplex 5'-d(TTAGGG)4-3', respectively, had dissociation constants, Kd, of 2.2 or 13.4 nM. Relative to d(TTAGGG)4, complexes with 5'-r(UUAGGG)4-3', blunt-ended duplex telomeric DNA, or quadruplex telomeric DNA had >10 to >250-fold higher Kd values. Single base alterations within the d(TTAGGG) repeat increased the Kd of complexes with uqTBP25 by 9-215-fold. Association with uqTBP25 protected d(TTAGGG)4 against nuclease digestion, suggesting a potential role for the protein in telomeric DNA transactions.

Animals↗

PubMed2000

Binding of an RNA trafficking response element to heterogeneous nuclear ribonucleoproteins A1 and A2.

Heterogeneous nuclear ribonucleoprotein (hnRNP) A2 binds a 21-nucleotide myelin basic protein mRNA response element, the A2RE, and A2RE-like sequences in other localized mRNAs, and is a trans-acting factor in oligodendrocyte cytoplasmic RNA trafficking. Recombinant human hnRNPs A1 and A2 were used in a biosensor to explore interactions with A2RE and the cognate oligodeoxyribonucleotide. Both proteins have a single site that bound oligonucleotides with markedly different sequences but did not bind in the presence of heparin. Both also possess a second, specific site that bound only A2RE and was unaffected by heparin. hnRNP A2 bound A2RE in the latter site with a K(d) near 50 nm, whereas the K(d) for hnRNP A1 was above 10 microm. UV cross-linking assays led to a similar conclusion. Mutant A2RE sequences, that in earlier qualitative studies appeared not to bind hnRNP A2 or support RNA trafficking in oligodendrocytes, had dissociation constants above 5 microm for this protein. The two concatenated RNA recognition motifs (RRMs), but not the individual RRMs, mimicked the binding behavior of hnRNP A2. These data highlight the specificity of the interaction of A2RE with these hnRNPs and suggest that the sequence-specific A2RE-binding site on hnRNP A2 is formed by both RRMs acting in cis.

Amino Acid Sequence↗

PubMed1991

Physical studies of tyrosine and tryptophan residues in mammalian A1 heterogeneous nuclear ribonucleoprotein. Support for a segmented structure.

The mammalian heterogeneous ribonucleoprotein (hnRNP) A1 and its constituent N-terminal domain, termed UP1, have been studied by steady-state and dynamic fluorimetry, as well as phosphorescence and optically detected magnetic resonance (ODMR) spectroscopy at cryogenic temperatures. The results of these diverse techniques coincide in assigning the site of the single tryptophan residue of A1, located in the UP1 domain, to a partially solvent-exposed site distal to the protein's nucleic acid binding surface. In contrast, tyrosine fluorescence is significantly perturbed when either protein associates with single-stranded polynucleotides. Tyr to Trp energy transfer at the singlet level is found for both UP1 and A1 proteins. Single-stranded polynucleotide binding induces a quenching of their intrinsic fluorescence emission, which can be attributed to a significant reduction (greater than 50%) of the Tyr contribution, while Trp emission is only quenched by approximately 15%. Tyrosine quenching effects of similar magnitude are seen upon polynucleotide binding by either UP1 (1 Trp, 4 Tyr) or A1 (1 Trp, 12 Tyr), strongly suggesting that Tyr residues in both the N-terminal and C-terminal domain of A1 are involved in the binding process. Tyr phosphorescence emission was strongly quenched in the complexes of UP1 with various polynucleotides, and was attributed to triplet state energy transfer to nucleic acid bases located in the close vicinity of the fluorophore. These results are consistent with stacking of the tyrosine residues with the nucleic acid bases. While the UP1 Tyr phosphorescence lifetime is drastically shortened in the polynucleotide complex, no change of phosphorescence emission maximum, phosphorescence decay lifetime or ODMR transition frequencies were observed for the single Trp residue. The results of dynamic anisotropy measurements of the Trp fluorescence have been interpreted as indicative of significant internal flexibility in both UP1 and A1, suggesting a flexible linkage connecting the two sub-domains in UP1. Theoretical calculations based on amino acid sequence for chain flexibility and other secondary structural parameters are consistent with this observation, and suggest that flexible linkages between sub-domains may exist in other RNA binding proteins. While the dynamic anisotropy data are consistent with simultaneous binding of both the C-terminal and the N-terminal domains to the nucleic acid lattice, no evidence for simultaneous binding of both UP1 sub-domains was found.

Amino Acid Sequence↗

PubMed1988

Phenylalanines that are conserved among several RNA-binding proteins form part of a nucleic acid-binding pocket in the A1 heterogeneous nuclear ribonucleoprotein.

We have studied the domain structure of the A1 heterogeneous nuclear ribonucleoprotein using both partial proteolysis and photochemical cross-linking to oligodeoxynucleotides. Both the intact A1 protein and its proteolytic fragment, the UP1 protein, can be cleaved by Staphylococcus aureus V-8 protease to produce two polypeptides of 92 amino acids. These two polypeptides correspond to the internal repeat sequence previously noted by us to occur in UP1. The two polypeptides can be purified via single-stranded DNA cellulose chromatography and independently cross-linked to [32P]p(dT)8, indicating that each domain can bind to single-stranded nucleic acids. Purification and sequencing of A1 tryptic peptides that had been cross-linked to oligothymidylic acid revealed that 4 phenylalanine residues, phenylalanines 16, 58, 107, and 149 are the sites of covalent adduct formation, with phenylalanine 16 being the major site of cross-linking. These phenylalanine residues are internally homologous when the repeat sequences in A1 are aligned, that is, phenylalanines 16 and 107 occupy analogous positions in the 91-residue repeat, as do phenylalanines 58 and 149. An examination of the primary structures of a variety of eucaryotic RNA-binding proteins with sequence homology to A1 reveals that the cross-linked phenylalanines in A1 are highly conserved among all of these proteins. Our results provide the first experimental evidence that conserved residues in the 90-amino acid repeating domains shared by A1 and other single-stranded nucleic acid binding-proteins form part of an RNA-binding pocket.

Amino Acid Sequence↗

PubMed2002

Recruitment of heterogeneous nuclear ribonucleoprotein A1 in vivo to the LMP/TAP region of the major histocompatibility complex.

Sequences containing the matrix recognition signature were identified adjacent to the LMP/TAP gene cluster in the human and mouse major histocompatibility complex class II region. These sequences were shown to function as nuclear matrix attachment regions (MARs). Three of the five human MARs and the single mouse MAR recruit heterogeneous nuclear ribonucleoprotein A1 (hnRNP-A1) in vivo during transcriptional up-regulation of the major histocompatibility complex class II genes. The timing of this recruitment correlates with a rise in mature TAP1 mRNA. Two of the human MARs bind hnRNP-A1 in vitro directly within a 35-bp sequence that shows over 90% similarity to certain Alu repeat sequences. This study shows that MARs recruit and bind hnRNP-A1 upon transcriptional up-regulation.

ATP Binding Cassette Transporter, Subfamily B, Mem↗

PubMed1999

Formation of a ribonucleoprotein complex of mouse hepatitis virus involving heterogeneous nuclear ribonucleoprotein A1 and transcription-regulatory elements of viral RNA.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) specifically binds to two transcription-regulatory elements, i.e., the leader and intergenic sequence, of the negative-strand (template-strand) RNA of mouse hepatitis virus (MHV) and may play a role in viral RNA transcription. Previous studies based on the defective-interfering RNAs of MHV suggested that these two RNA elements may interact with each other during transcription, although they do not have complementary sequences. In this study, we showed by an in vitro reconstitution assay that hnRNP A1 could mediate the formation of an RNP complex involving these two RNA elements. Both the RNA-binding domains and protein-interacting domain of hnRNP A1 contributed to the efficient formation of the RNP complex; however, the presence of the two RNA-binding domains alone, without the protein-interacting domain, also resulted in some RNP formation. Omission of hnRNP A1 in the reconstitution reaction abolished the RNP formation, and mutations of the IG sequences significantly inhibited the RNP formation. These findings suggest that the two cis-acting transcription-regulatory sequences of MHV RNA can interact with each other through the formation of an RNP complex involving a cellular protein hnRNP A1. This RNP complex may participate in MHV RNA transcription.

Animals↗

PubMed2000

Heterogeneous nuclear ribonucleoprotein A1 regulates RNA synthesis of a cytoplasmic virus.

Heterogeneous nuclear ribonucleoprotein (hnRNP A1) is involved in pre-mRNA splicing in the nucleus and translational regulation in the cytoplasm. In the present study, we demonstrate that hnRNP A1 also participates in the transcription and replication of a cytoplasmic RNA virus, mouse hepatitis virus (MHV). Overexpression of hnRNP A1 accelerated the kinetics of viral RNA synthesis, whereas the expression in the cytoplasm of a dominant-negative hnRNP A1 mutant that lacks the nuclear transport domain significantly delayed it. The hnRNP A1 mutant caused a global inhibition of viral mRNA transcription and genomic replication, and also a preferential inhibition of the replication of defective-interfering RNAs. Similar to the wild-type hnRNP A1, the hnRNP A1 mutant complexed with an MHV polymerase gene product, the nucleocapsid protein and the viral RNA. However, in contrast to the wild-type hnRNP A1, the mutant protein failed to bind a 250 kDa cellular protein, suggesting that the recruitment of cellular proteins by hnRNP A1 is important for MHV RNA synthesis. Our findings establish the importance of cellular factors in viral RNA-dependent RNA synthesis.

Animals↗

PubMed1993

Association of heterogeneous nuclear ribonucleoprotein A1 and C proteins with reiterated AUUUA sequences.

Post-transcriptional regulatory mechanisms have been shown to play a major role in gene expression in eukaryotic cells. The presence of a reiterated pentamer (AUUUA) in the 3'-untranslated region (UTR) of mRNAs encoding lymphokines, cytokines, transcription factors, and proto-oncogenes has been shown to be associated with rapid turnover and translation attenuation. Cytoplasmic proteins (70, 50, 43, 36, and 25 kDa) capable of specifically binding to RNAs containing these AU-rich sequences were identified in human peripheral blood T lymphocytes. Levels of the 36-kDa protein were markedly increased following transcriptional, but not translational inhibition, a feature recently reported for hnRNP A1, a protein of comparable mass. Antibodies directed against heterogeneous nuclear ribonucleoproteins (hnRNPs) A1 and C immunoprecipitated 36- and 43-kDa proteins that had bound the AUUUA-rich region contained in the 3'-UTR of granulocyte-macrophage colony-stimulating factor mRNA. Recombinant hnRNP A1 was shown to preferentially bind to RNAs containing AUUUA sequences in a specific manner, and displayed comparable patterns to the 36-kDa AU-specific binding proteins following partial proteolysis. These data identify for the first time hnRNP A1 and C as cytoplasmic proteins in human lymphocytes that are capable of specifically associating with reiterated AUUUA sequences present in the 3'-UTR of labile mRNAs. As such, they may play a role as trans-acting factors in the modulation of cytoplasmic mRNA turnover and translation, in addition to their previously characterized roles as pre-mRNA binding proteins involved in nuclear mRNA processing.

Binding, Competitive↗

PubMed1992

Retroviral insertions downstream of the heterogeneous nuclear ribonucleoprotein A1 gene in erythroleukemia cells: evidence that A1 is not essential for cell growth.

A large number of novel cellular proto-oncogenes have been identified and cloned by analysis of common integration sites in retrovirally induced malignancies. In the multistage erythroleukemias induced by the various strains of Friend leukemia virus, the analysis of proviral-integration events has led to the identification of two genes, Fli-1 and Spi-1, both novel members of the ets oncogene family of transcription factors. In this report, we describe the identification of another integration site, designated Fli-2 (Friend leukemia virus integration-2), in an erythroleukemia cell line induced by Friend murine leukemia virus (F-MuLV). Rearrangements at the Fli-2 locus were found in two erythroleukemia cell lines independently induced by F-MuLV and one leukemic cell line derived from the spleen of a mouse infected with the polycythemia strain of Friend leukemia virus. The deduced amino acid sequence of a cDNA corresponding to a transcript originating from genomic DNA adjacent to Fli-2 is identical to that of the human heterogeneous nuclear ribonucleoprotein A1 gene, a member of the gene family of RNA-binding proteins involved in RNA splicing. In one erythroleukemia cell line, A1 expression was undetectable as a result of F-MuLV integration in one allele and loss of the other allele. These results suggest that perturbations in RNA splicing mechanisms may contribute to malignant transformation and provide direct evidence that the A1 protein is not required for cell growth.

Amino Acid Sequence↗

PubMed2002

Heterogeneous nuclear ribonucleoprotein A1 and regulation of the xenobiotic-inducible gene Cyp2a5.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) functions in the packaging of nascent RNA polymerase II transcripts and participates in a variety of nuclear and cytoplasmic processes that modulate gene expression. The RNA binding characteristics of hnRNP A1 suggest that it can modulate the expression of specific genes, but little is known about its possible targets in vivo. In this article, we show that hnRNP A1 interacts with the transcript of a cytochrome P450 gene, Cyp2a5, induced by xenobiotics and during liver damage. Binding of the hnRNP A1 to CYP2A5 mRNA was demonstrated by immunoprecipitation of the xenobiotic-stimulated (37/39 kDa) CYP2A5 mRNA-protein complex with a monoclonal anti-hnRNP A1 antibody, by partial trypsin digestion of the complex, and by showing that the RNA-protein complex is not formed with protein extracts from cells lacking the hnRNP A1. We also show that a specific hepatotoxic inducer of the Cyp2a5 gene, pyrazole, increases the cytoplasmic levels of hnRNP A1 in vivo. Finally, we show that hnRNP A1 can be overexpressed in mouse primary hepatocytes, leading to an accumulation of the CYP2A5 mRNA. Collectively, these results indicate that the hnRNP A1 is an important regulator of the Cyp2a5 gene.

Animals↗

PubMed2005

Regulation of heterogenous nuclear ribonucleoprotein A1 transport by phosphorylation in cells stressed by osmotic shock.

Heterogeneous nuclear ribonucleoprotein (hnRNP) A1 is an alternative splicing factor that is mainly nuclear, although it shuttles rapidly between nuclear and cytoplasmic compartments. Cells stressed by osmotic shock (OSM) activate the mitogen-activated protein kinase kinase(3/6)-p38 signaling pathway, which in turn results in accumulation of hnRNP A1 in the cytoplasm. This effect modulates alternative splicing regulation in vivo and correlates with increased hnRNP A1 phosphorylation. We have characterized the molecular mechanism involved in the cytoplasmic accumulation of hnRNP A1 in NIH 3T3 cells subjected to OSM. This treatment results in serine-specific phosphorylation within a C-terminal peptide, dubbed the "F-peptide," which is adjacent to the M9 motif that mediates bidirectional transport of hnRNP A1. Analysis of mutants in which the F-peptide serines were replaced by aspartic acids or alanines showed that F-peptide phosphorylation is required for the subcellular redistribution of hnRNP A1 in cells subjected to OSM. Furthermore, F-peptide phosphorylation modulates the interaction of hnRNP A1 with transportin Trn1. Our findings suggest that the phosphorylation of F-peptide by cell-signaling pathways regulates the rate of hnRNP A1 nuclear import.

Active Transport, Cell Nucleus↗

PubMed1994

Both RNA-binding domains in heterogenous nuclear ribonucleoprotein A1 contribute toward single-stranded-RNA binding.

Heterogenous nuclear ribonucleoproteins (hnRNPs) such as hnRNP A1 are tightly associated with heterogenous nuclear RNAs (hnRNAs) within eukaryotic nuclei and are thought to be involved in hnRNA processing and splice site selection. The NH2-terminal two-thirds of hnRNP A1 contains two 92-amino acid RNA binding domains (RBDs) that are arranged in tandem and are more than 30% homologous with each other. Following this region is a flexible glycine-rich COOH-terminal domain. We have studied the nucleic acid binding properties of the two isolated RBDs (residues 1-92 and 93-184, respectively) and of A1 fragments corresponding to residues 1-184 and 1-196 (i.e., the latter fragment is called UP1) in order to evaluate their relative contributions to A1 binding. We have determined that the individual RBDs of A1 bind poly[r(epsilon A)], a fluorescent single-stranded RNA (ssRNA), with a surprisingly low apparent association constant of only 1.5 x 10(4) M-1 (1-92) and 4.5 x 10(4) M-1 (93-184), respectively. We hypothesize that this low affinity represents a basal level of binding that is common to most RBD-containing proteins. Oligonucleotide binding studies suggest the interaction site size for the 93-184 fragment is approximately 4 nucleotides or less and salt sensitivity studies indicate that only about 27% of the free energy of binding of this RBD derives from ionic interactions. Since the affinity of the 1-184 fragment is at least 10-fold above that of either of its component RBDs, both must contribute to binding. This conclusion is further supported by the increased occluded site size of 1-184 (n = 14 +/- 2), as compared to its 93-184 RBD (n = 6 +/- 1), and by the biphasic binding that was observed for the UP1:poly(U) interaction at pH 6.0. Our finding that the affinity of the 1-184 fragment is 1000-fold less than the product of the affinities of its 1-92 and 93-184 RBDs is consistent with these domains being joined by a flexible linker. By comparing the affinities of the 1-184 fragment with that for A1, we conclude that together the two RBDs in A1 account for only 53% of the free energy of A1 binding. Comparative binding studies with UP1 demonstrate that the short region spanning residues 185-->195 represents an important determinant of the binding affinity of A1 and, since this region contains a site of dimethylation, it may provide a mechanism for regulating the affinity of A1 for specific nucleic acid targets.

Amino Acid Sequence↗

PubMed2003

Specific interaction of heterogeneous nuclear ribonucleoprotein A1 with the -219T allelic form modulates APOE promoter activity.

The polymorphic -219T/G variant in the APOE promoter has been associated with variations in basal transcriptional activity as well as with the risk of developing Alzheimer's disease, myocardial infarction and early-onset coronary heart disease. The molecular mechanisms underlying these effects are presently unknown. In this report, we show that nuclear extracts from Jurkat cells form a T-specific complex with a motif including the -219 site within the APOE promoter. By DNA-affinity chromatography and mass spectrometry, the human heterogeneous nuclear ribonucleoprotein hnRNPA1(A1) was identified as one component of the complex. In vitro binding analysis indicated that a fragment of A1 had a marked binding specificity for the T form. Interaction of A1 with this region is driven by an adjacent telomeric-like sequence; however, the presence of G, but not T, at -219 position inhibited this interaction. The differences in transcriptional activity between the -219T and -219G promoter allelic forms correlated with the expression levels of A1 in several cell lines; also, over-expression of A1 increased the activity of the T form relative to that of the G form. These results indicate that A1 transactivates APOE promoter activity by direct and specific interaction with the -219T site.

Alleles↗

PubMed1997

Modulation of AUUUA response element binding by heterogeneous nuclear ribonucleoprotein A1 in human T lymphocytes. The roles of cytoplasmic location, transcription, and phosphorylation.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) shuttles between the cytoplasm and nucleus and plays important roles in RNA metabolism. Whereas nuclear hnRNP A1 has been shown to bind intronic sequences and modulate splicing, cytoplasmic hnRNP A1 is associated with poly(A)+ RNA, indicating different RNA ligand specificity. Previous studies indicated that cytoplasmic hnRNP A1 is capable of high-affinity binding of reiterated AUUUA sequences (ARE) that have been shown to modulate mRNA turnover and translation. Through a combination of two-dimensional gel and proteolysis studies, we establish hnRNP A1 (or structurally related proteins that are post-translationally regulated in an identical manner) as the dominant cytoplasmic protein in human T lymphocytes capable of interacting with the ARE contained within the context of full-length granulocyte-macrophage colony-stimulating factor mRNA. We additionally demonstrate that cytoplasmic hnRNP A1 preferentially binds ARE relative to pre-mRNAs in both cross-linking and mobility shift experiments. RNA polymerase II inhibition increased the binding of ARE (AUBP activity) and poly(U)-Sepharose by cytoplasmic hnRNP A1, while nuclear hnRNP A1 binding was unaffected. Nuclear and cytoplasmic hnRNP A1 could be distinguished by the differential sensitivity of their RNA binding to diamide and N-ethylmaleimide. The increase in AUBP activity of cytoplasmic hnRNP A1 following RNA polymerase II inhibition correlated with serine-threonine dephosphorylation, as determined by inhibitor and metabolic labeling studies. Thus, cytoplasmic and nuclear hnRNP A1 exhibit different RNA binding profiles, perhaps transduced through serine-threonine phosphorylation. These findings are relevant to the specific ability of hnRNP A1 to serve distinct roles in post-transcriptional regulation of gene expression in both the nucleus and cytoplasm.

Adenosine↗

PubMed1993

Modulation of exon skipping and inclusion by heterogeneous nuclear ribonucleoprotein A1 and pre-mRNA splicing factor SF2/ASF.

The essential splicing factor SF2/ASF and the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) modulate alternative splicing in vitro of pre-mRNAs that contain 5' splice sites of comparable strengths competing for a common 3' splice site. Using natural and model pre-mRNAs, we have examined whether the ratio of SF2/ASF to hnRNP A1 also regulates other modes of alternative splicing in vitro. We found that an excess of SF2/ASF effectively prevents inappropriate exon skipping and also influences the selection of mutually exclusive tissue-specific exons in natural beta-tropomyosin pre-mRNA. In contrast, an excess of hnRNP A1 does not cause inappropriate exon skipping in natural constitutively or alternatively spliced pre-mRNAs. Although hnRNP A1 can promote alternative exon skipping, this effect is not universal and is dependent, e.g., on the size of the internal alternative exon and on the strength of the polypyrimidine tract in the preceding intron. With appropriate alternative exons, an excess of SF2/ASF promotes exon inclusion, whereas an excess of hnRNP A1 causes exon skipping. We propose that in some cases the ratio of SF2/ASF to hnRNP A1 may play a role in regulating alternative splicing by exon inclusion or skipping through the antagonistic effects of these proteins on alternative splice site selection.

Animals↗

PubMed1990

Renaturation of complementary DNA strands mediated by purified mammalian heterogeneous nuclear ribonucleoprotein A1 protein: implications for a mechanism for rapid molecular assembly.

Purified heterogeneous nuclear ribonucleoprotein (hnRNP) A1 protein, which is found in vivo associated with heterogeneous nuclear RNA (hnRNA), promotes the rapid renaturation of nucleic acid strands. Maximal renaturation activity requires the glycine-rich carboxyl-terminal one-third of the protein, although the amino-terminal two-thirds also has activity. The A1-mediated reaction is second-order with respect to complementary DNA concentration, and the renaturation rate constant at 37 degrees C with A1 is about 3000-fold greater than in the absence of the protein. At 60 degrees C, the A1-mediated renaturation rate is even faster, and is about 300-fold greater than protein-free reactions carried out at 68 degrees C in 1 M NaCl. Provided that sufficient A1 protein is present to coat all strands in solution, the presence of nonhomologous, single-stranded DNA does not significantly inhibit the reaction. Moreover, renaturation of short strands to their complement contained in very long strands is nearly as efficient as between two short strands. These results indicate that A1 may be useful for procedures that rely on nucleic acid renaturation. We propose that A1 promotes rapid renaturation primarily by reducing the entropic barrier of bimolecular strand association through relatively transient interactions between A1-coated strands. Such interactions, mediated by flexible repeating domains, may act generally to increase the association kinetics of highly specific molecular assemblies in processes such as RNA maturation, transcription, translation, and transport.

Coliphages↗

PubMed1999

The nucleocapsid protein of coronavirus mouse hepatitis virus interacts with the cellular heterogeneous nuclear ribonucleoprotein A1 in vitro and in vivo.

The nucleocapsid (N) protein of mouse hepatitis virus (MHV) and the cellular heterogeneous nuclear ribonucleoprotein A1 (hnRNP-A1) are RNA-binding proteins, binding to the leader RNA and the intergenic sequence of MHV negative-strand template RNAs, respectively. Previous studies have suggested a role for both N and hnRNP-A1 proteins in MHV RNA synthesis. However, it is not known whether the two proteins can interact with each other. Here we employed a series of methods to determine their interactions both in vitro and in vivo. Both N and hnRNP-A1 genes were cloned and expressed in Escherichia coli as glutathione S-transferase (GST) fusion proteins, and their interactions were determined with a GST-binding assay. Results showed that N protein directly and specifically interacted with hnRNP-A1 in vitro. To dissect the protein-binding domain on the N protein, 15 deletion constructs were made by PCR and expressed as GST fusion proteins. Two hnRNP-A1-binding sites were identified on N protein: site A is located at amino acids 1 to 292 and site B at amino acids 392 to 455. In addition, we found that N protein interacted with itself and that the self-interacting domain coincided with site A but not with site B. Using a fluorescence double-staining technique, we showed that N protein colocalized with hnRNP-A1 in the cytoplasm, particularly in the perinuclear region, of MHV-infected cells, where viral RNA replication/transcription occurs. The N protein and hnRNP-A1 were coimmunoprecipitated from the lysates of MHV-infected cells either by an N- or by an hnRNP-A1-specific monoclonal antibody, indicating a physical interaction between N and hnRNP-A1 proteins. Furthermore, using the yeast two-hybrid system, we showed that N protein interacted with hnRNP-A1 in vivo. These results thus establish that MHV N protein interacts with hnRNP-A1 both in vitro and in vivo.

Animals↗