SEARCH · PubMed Health

Results for “LIFR gene”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed1993

The leukemia inhibitory factor receptor (LIFR) gene is located within a cluster of cytokine receptor loci on mouse chromosome 15 and human chromosome 5p12-p13.

The leukemia inhibitory factor receptor (LIFR) gene was localized to human chromosome 5p12-p13 by somatic cell hybrid analysis. Interspecific backcross analysis revealed that the murine locus was on chromosome 15 in a region of homology with human chromosome 5p. In both human and mouse genomes, the LIFR locus was linked to the genes encoding the receptors for interleukin-7, prolactin, and growth hormone.

Animals↗

PubMed1997

Identification of an upstream enhancer within a functional promoter of the human leukemia inhibitory factor receptor gene and its alternative promoter usage.

Knockout of the leukemia inhibitory factor receptor (LIFR) gene results in disrupted placental architecture, imbalanced bone development, and losses of functional neurons. We here report the identification of an enhancer in a functional human LIFR gene promoter and alternative promoter usage by this gene. A single transcription start site was identified in placental JEG-3 cells and a genomic clone containing 4876-nucleotide upstream sequences was found to have promoter activity in JEG-3 cells. However, in osteogenic sarcoma U-2 OS cell, Northern blot using a probe of the first exon detected in JEG-3 cells failed to detect LIFR transcripts. 5'-Rapid amplification of cDNA ends (RACE) revealed an alternative first exon and a 0.6-kilobase pair (kb) 5'-flanking region possessed promoter activity in U-2 OS cells. For the 4.8-kb promoter active in placental cells, a minimal promoter was localized within -162 nucleotides. Three regions increased and one inhibited promoter activity. Subcloning of an activation region (-4876 to -3453 nucleotides) into SV40 promoter either upstream or downstream in either orientation to the luciferase reporter resulted in 10-35-fold luciferase induction, demonstrating the characteristics of an enhancer. Transfections into nine cell lines of different tissue origin indicated that the cloned promoter and enhancer in the 4.8-kb fragment was placental tissue-specific. A 226-base pair fragment (-4625 to -4400 nucleotides) was further localized as the minimal enhancer region, in which deletion of either element A (-4625 to -4581 nucleotides) or element B (-4418 to -4400 nucleotides) resulted in the loss of enhancer activity. Electrophoretic mobility shift assay confirmed that these two elements bind to specific nuclear proteins individually. In the middle region between element A and B, disruption of enhancer integrity also led to a loss of enhancer activity, although two SP1 and three NF-kappaB/c-Rel binding sites did not contribute to enhancer function. These results demonstrate a complex regulation of the human LIFR gene, including alternative promoter usage and tissue-specific elements at the transcription level.

Base Sequence↗

PubMed1998

Functional map of a placenta-specific enhancer of the human leukemia inhibitory factor receptor gene.

We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (-4625/-4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (-4617/-4602) with nuclear extract was competed by a known Oct-1 oligo and supershifted by Oct-1 antibody. Specific binding of region B (-4549/-4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (-4464/-4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE, CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary of PSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of approximately 160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in human LIFR gene.

Binding Sites↗

PubMed2026

Severe Suprasystemic Refractory Pulmonary Hypertension in a Neonate with Stüve-Wiedemann Syndrome Associated with Biallelic LIFR Variants: Molecular Insights and a Neonatal Case Report.

Stüve-Wiedemann syndrome (SWS) is an ultra-rare autosomal recessive skeletal dysplasia caused by loss-of-function variants in the leukemia inhibitory factor receptor (LIFR) gene. While characterized by bone deformities and dysautonomia, severe persistent pulmonary hypertension of the newborn (PPHN) significantly contributes to high early mortality. We report a neonate with genetically confirmed SWS who presented with severe, suprasystemic PPHN refractory to standard pulmonary vasodilators, including inhaled nitric oxide. This case provides a detailed longitudinal hemodynamic characterization of severe suprasystemic PPHN in genetically confirmed SWS, including serial assessment of pulmonary pressures, shunt direction, and right ventricular function during treatment. Rather than identifying PPHN as a novel manifestation of SWS, it extends the phenotypic and hemodynamic characterization of pulmonary vascular involvement in this rare disorder.

Humans↗

PubMed2006

The leukemia inhibitory factor receptor gene is not involved in the etiology of pituitary dwarfism in German shepherd dogs.

Pituitary dwarfism in German shepherd dogs is characterized by combined pituitary hormone deficiency (CPHD) and intrapituitary cyst formation. Activation of the leukemia inhibitory factor (LIF)-LIF receptor (LIFR) signal transduction pathway results in a similar phenotype in (transgenic) mice. We therefore assessed the role of the LIFR in the etiology of pituitary dwarfism in German shepherd dogs. A polymorphic microsatellite marker (UULIFR) was used to analyze the segregation of the LIFR gene in 22 German shepherd dogs from 4 pedigrees, each including one dwarf. There was no allelic association between UULIFR and the dwarfism phenotype. Based on our findings LIFR was excluded as a candidate gene for CPHD.

Animals↗

PubMed2004

Stage-specific expression of leukaemia inhibitory factor and its receptor in rabbit pre-implantation embryo and uterine epithelium during early pregnancy.

Leukaemia inhibitory factor (LIF) has been shown to play an important role in the development and implantation of blastocysts in mice. In the current study, the reverse transcription-polymerase chain reaction (RT-PCR) was employed to examine the expression patterns of LIF and its receptor (LIFR) genes in rabbit embryos during pre-implantation development, and the uterine expression of LIF and LIFR was also evaluated by Western blotting. Transcripts for LIFR were detected within morula and blastocyst-stage embryos, while the LIF mRNA was only found in blastocysts (from early to fully expanded blastocoel cavities), indicating that embryo-derived LIF can act in an autocrine manner on the process of blastocyst formation. The expression levels of LIF and LIFR in uterine epithelium were gradually increased during pre-implantation period and reached their highest levels on days 6.5 of pregnancy, just before the time of blastocyst implantation, suggest that paracrine LIF circuit should exist between the endometrium and the early embryos, which may be involved in the embryo-maternal dialogue and important for the blastocyst implantation. The data present here show the stage-specific and dynamic expression patterns of LIF and LIFR, both in embryos and endometrium, during early pregnancy in rabbits, which indicated that LIF might play an important role in the pre-implantation development and subsequent implantation of rabbit embryos.

Animals↗

PubMed1997

Recent evolutionary acquisition of alternative pre-mRNA splicing and 3' processing regulations induced by intronic B2 SINE insertion.

Contrary to the membrane-anchored leukemia inhibitory factor receptor (LIFR), the mouse soluble LIFR is an inhibitor of LIF action, possibly through a ligand titration effect. Two mRNA species encoding the soluble LIFR have been identified. Since the 3'-untranslated end of the shorter form was shown to contain a B2 element, we have examined the possibility that this SINE may be responsible for LIFR mRNA truncation. Transient expression assays, using B2-derived or intron-derived sequences independently or in conjunction, show that the B2 element has fortuitously unmasked a cryptic pre-mRNA 3'processing activity of silent intron sequences. The corresponding locus of the rat genome has been isolated and was shown to be devoid of any retroposon, which may explain why no soluble LIFR has yet been identified in any other species and further indicates that the B2 insertion event in the mouse LIFR gene has occurred recently during evolution. And yet, a tight tissue-specific regulation of alternative synthesis of soluble and membrane-bound LIFR mRNA has already emerged in mice. These results provide striking evidence for the rapid influence of retroposition on genome expression.

Alternative Splicing↗

PubMed1996

[Expression of LIF as autocrinal growth factor in human medulloblastomas].

In this study, in vivo and in vitro expression of LIF and its signal transducer genes, LIFR and gp130 in medulloblastoma cells and its role(s) in the cell proliferation were investigated by different approaches. The results revealed that 12 out of 13 cases examined were found to express LIF and more than 90% of the samples to express LIFR and gp130. Functional evaluation of LIF using Med-3 cells showed that the cell growth and DNA synthesis could be efficiently inhibited (P < 0.001) by neutralization of LIF bioactivity. Our data thus demonstrated the importance of LIF as autocrtinal growth factor in the proliferation of medulloblastoma cells and also implicated a potential new therapeutic approach for a better treatment of the tumors through blockage of LIF gene expression and/or ligand interaction.

Antigens, CD↗

PubMed2003

DNA methylation controls the responsiveness of hepatoma cells to leukemia inhibitory factor.

The related members of the interleukin 6 (IL-6) family of cytokines, IL-6, leukemia inhibitory factor (LIF), and oncostatin M, act as major inflammatory mediators and induce the hepatic acute phase reaction. Normal parenchymal liver cells express the receptors for these cytokines, and these receptors activate, to a comparable level, the intracellular signaling through signal transducer and activator of transcription (STAT) proteins and extracellular-regulated kinase (ERK). In contrast, hepatoma cell lines show attenuated responsiveness to some of these cytokines that is correlated with lower expression of the corresponding ligand-binding receptor subunits. This study tests the hypothesis that the reduced expression of LIF receptor (LIFR) observed in hepatoma cells is mediated by altered DNA methylation. H-35 rat hepatoma cells that have a greatly reduced LIF responsiveness were treated with 5-aza-2'-deoxycytidine, an inhibitor of DNA methyltransferase. Surviving and proliferating cells showed reestablished expression of LIFR protein and function. Restriction landmark genomic scanning (RLGS) demonstrated genome-wide drug-induced alterations in DNA methylation status, with striking similarities in the demethylation pattern among independently derived clonal lines. Upon extended growth in the absence of 5-aza-2'-deoxycytidine, the cells exhibit partial reversion to pretreatment patterns. Demethylation and remethylation of the CpG island within the LIFR promoter that is active in normal liver cells correlate with increased and decreased usage of this promoter in H-35 cells. In conclusion, these results indicate that transformed liver cells frequently undergo epigenetic alterations that suppress LIFR gene expression and modify the responsiveness to this IL-6 type cytokine.

Animals↗

PubMed1994

Ciliary neurotropic factor, interleukin 11, leukemia inhibitory factor, and oncostatin M are growth factors for human myeloma cell lines using the interleukin 6 signal transducer gp130.

Interleukin 6 (IL-6) is a major growth factor for tumor plasma cells involved in human multiple myeloma (MM). In particular, human myeloma cell lines (HMCL), whose growth is completely dependent on addition of exogenous IL-6, can be obtained reproducibly from every patient with terminal disease. Four cytokines, ciliary neurotropic factor (CNTF), IL-11, leukemia inhibitory factor (LIF), and oncostatin M (OM), use the same transducer chain (signal transducer gp130) as IL-6 and share numerous biological activities with this IL. We found that these four cytokines stimulated proliferation and supported the long-term growth of two out of four IL-6-dependent HMCL obtained in our laboratory. Half-maximal proliferation was obtained with cytokine concentrations ranging from 0.4 to 1.2 ng/ml for IL-11, LIF, and OM. CNTF worked at high concentrations only (90 ng/ml), but addition of soluble CNTF receptor increased sensitivity to CNTF 30-fold. The growth-promoting effect of these four cytokines was abrogated by anti-gp130 antibodies, contrary to results for anti-IL-6 receptor or anti-IL-6 antibodies. No detectable changes in the morphology and phenotype were found when myeloma cells were cultured with one of these four cytokines instead of IL-6. Concordant with their IL-6-dependent growth, the four HMCL expressed membrane IL-6R and gp130 detected by FACS analysis. LIF-binding chain gene (LIFR) was expressed only in the two HMCL responsive to LIF and OM.

Antigens, CD↗

PubMed2002

Mapping and microsatellite marker development for the porcine leukemia inhibitory factor receptor (LIFR) and epidermal growth factor receptor (EGFR) genes.

Leukemia inhibitory factor receptor (LIFR), epidermal growth factor receptor (EGFR), and their respective ligands have been implicated in regulating growth and development of the early pig conceptus. We isolated a PAC clone containing the porcine gene for LIFR and a BAC clone with the porcine EGFR gene, respectively. On each of these clones one microsatellite marker was identified by sequencing a collection of subclones. These gene-associated markers were evaluated by genotyping of 202 unrelated boars of four different breeds. Based on fluorescence in situ hybridization and radiation hybrid mapping, the porcine LIFR gene was assigned to SSC16q13-->q14. The EGFR gene mapped to SSC9q26.

Animals↗

PubMed1998

The recurrent translocation t(5;8)(p13;q12) in pleomorphic adenomas results in upregulation of PLAG1 gene expression under control of the LIFR promoter.

We have previously shown that the PLAG1 gene on chromosome 8q12 is consistently rearranged in pleomorphic adenomas of the salivary glands with t(3;8)(p21;q12) translocations. The t(3;8) results in promoter swapping between the PLAG1 gene, which encodes a novel zinc finger protein, and the constitutively expressed gene for beta-catenin (CTNNB1), a protein with roles in cell-cell adhesion and the WG/WNT signalling pathway. In order to assess the importance of other translocation partner genes of PLAG1, and their possible relationship to CTNNB1, we have characterized a second recurrent translocation, i.e. the t(5;8)(p13;q12). This translocation leads to ectopic expression of a chimeric transcript consisting of sequences from the ubiquitously expressed gene for the leukemia inhibitory factor receptor (LIFR) and PLAG1. As for the t(3;8), the fusions occurred in the 5'-noncoding regions of both genes, exchanging regulatory control elements while preserving the coding sequences. The results of the current as well as previous studies indicate that ectopic expression of PLAG1 under the control of promoters of distinct translocation partner genes is a general pathogenetic mechanism for pleomorphic adenomas with 8q12 aberrations.

Adenoma↗

PubMed2005

Expression of functional ciliary neurotrophic factor receptors in immortalized gonadotrophin-releasing hormone-secreting neurones.

Ciliary neurotrophic factor (CNTF), a cytokine of the interleukin-6 superfamily, is known to exert pleiotropic actions, including regulation of food intake and permissive effects on reproduction, by facilitating the release of gonadotrophin-releasing hormone (GnRH) and gonadotrophins. CNTF activates membrane receptors (CNTF-Rs) composed of one ligand-specific binding subunit, defined CNTFR alpha, and two signal transducing subunits, termed leukaemia inhibitory factor receptor (LIFR) and gp130. However, it is not clear whether the effects of CNTF on GnRH release result from either a direct or an indirect action on GnRH-secreting hypothalamic neurones, or from a combination of these events. The hypothesis of a direct effect of CNTF was thus tested using the GT1-7 GnRH-secreting cell line. CNTF-R expression and CNTF-induced modulation of the Janus kinase (JAK2)-signal transducer and activator of transcription 3 (STAT3) pathway and of GnRH release were evaluated. GT1-7 cells were found to express CNTFR alpha, LIFR and gp130 genes, as shown by reverse transcription-polymerase chain reaction analysis, and the corresponding proteins, analysed by immunofluorescence and western blot. CNTFR alpha, LIFR and gp130 immunoreactive bands had an approximate size of 50, 190 and 130 kDa, respectively. Treatment of GT1-7 cells with 10(-12) M CNTF for 15-60 min resulted in a marked and transient increase of STAT3 phosphorylation via activation of JAK2. A 30-min exposure of GT1-7 cells to different CNTF concentrations increased the accumulation of GnRH into the culture medium, with a maximal effect at 10(-11) M. In conclusion, the present results provide new information about the regulation of the reproductive axis by CNTF, and suggest that it might operate at the hypothalamic level by directly influencing the activity of GnRH-secreting neurones, in addition to the possible indirect effects via interneurones proposed by previous studies.

Animals↗

PubMed1997

Ontogeny of elongation and gene expression in the early developing porcine conceptus.

Early porcine conceptus development is characterized by rapid trophoblastic elongation between Days 11 and 12 of pregnancy, a period of embryonic loss in the pig. Growth factors and steroids secreted by the conceptus and uterus, as well as ligand receptors produced by the conceptus, are thought to regulate trophoblastic elongation. Therefore, the objectives of this study were to characterize conceptus gene expression for the steroidogenic enzymes 17alpha-hydroxylase and aromatase and the mesodermal marker brachyury, as well as the expression of receptors for fibronectin (integrin beta-1), progesterone, estrogen, oxytocin, prostaglandin F2alpha, and leukemia inhibitory factor (LIF), prior to and during trophoblastic elongation. Total RNA was extracted from individual conceptuses from Day 10 to Day 12 of pregnancy. Gene expression was determined by reverse transcription polymerase chain reaction on conceptuses having 2- to 4-, 5-, 6-, 7-, 8-, 9-, and 10- to 12-mm spherical, 13- to 25-mm tubular, and > 100-mm filamentous morphologies. There was a stage of development effect on both 17alpha-hydroxylase (p < 0.001) and aromatase (p < 0.003) gene expression. Initial 17alpha-hydroxylase gene expression was detected in early spherical conceptuses (2-4 mm), increasing abruptly through to 7-mm conceptuses. Aromatase gene expression increased dramatically in 6- to 7-mm conceptuses, with increased expression throughout development. Gene expression for LIF receptor (LIFR) (p < 0.02) was similar to that for 17alpha-hydroxylase, while brachyury gene expression began in 6-mm conceptuses and increased (p < 0.001) throughout development. Integrin beta-1 was expressed at all stages of development. Conceptus gene expression was not detected for progesterone, estrogen, oxytocin, and prostaglandin F2alpha receptors. Prior to elongation, dynamic changes in gene expression are occurring that appear to be associated with estrogen production and preparation of the conceptuses for elongation. LIFR expression is highly associated with steroidogenic enzyme production with an initial peak preceding rapid trophoblastic elongation, suggesting that LIF may be involved in early conceptus development in the pig.

Animals↗

PubMedDate not supplied

Expression of leukemia-inhibitory factor as an autocrinal growth factor in human medulloblastomas.

Medulloblastoma is the most frequent pediatric brain tumor, with the capacities of rapid proliferation and intracranial dissemination. However, the factor(s) regulating medulloblastoma growth has not yet been well characterized. Leukemia-inhibitory factor (LIF) and interleukin-6 (IL-6) play different roles in the formation/progression of various embryonic and pediatric tumors, but their biological effects on medulloblastoma cells are less well known. Therefore, in vivo and in vitro expression of LIF, IL-6 and their signal transducer genes encoding LIF receptor (LIFR), IL-6 receptor (IL-6R) and gp130 in human medulloblastoma cells were investigated by multiple cellular and molecular biology approaches. The results revealed that LIF expression could be found in 26 out of 28 tumors/cell line and over 90% of the samples expressed LIFR, IL-6R and gp130. In contrast, none of the samples showed IL-6 expression. An established medulloblastoma cell line, Med-3, was used to evaluate the potential effects of LIF and IL-6 on the proliferation of medulloblastoma cells. The growth of Med-3 cells was efficiently inhibited either by anti-LIF antibody or by antisense LIF oligonucleotide. Addition of exogenous human recombinant IL-6 could dramatically enhance Med-3 cell outgrowth. Our data thus for the first time demonstrated the important role of LIF as an autocrinal and IL-6 as a paracrinal growth factor in the proliferation of medulloblastoma cells.

Blotting, Southern↗

PubMed1999

Leukemia inhibitory factor (LIF) and LIF receptor in human lung. Distribution and regulation of LIF release.

The distribution and regulation of leukemia inhibitory factor (LIF) and its receptor (LIFR) in human lung tissue is unknown. We recently found that LIF was immunolocalized to several cell types in human airways, and that exogenous LIF modulated neural and contractile responses of explanted airways. The present study aimed to determine the cellular distribution and regulation of gene transcripts for LIF and LIFR in human lung, and measured the release of LIF in response to anti-immunoglobulin (Ig)E, interleukin (IL)-1beta, and IL-6. Exposure of human lung to IL-1beta (100 pg/ml) resulted in the rapid induction of LIF messenger RNA (mRNA) (1 h) and subsequent protein release (6 h). Similar results were observed when lung tissue was exposed to anti-IgE (6 U/ml). Gene transcripts for LIF were observed in nine pulmonary cell types, with the greatest expression occurring in fibroblasts. LIFR transcripts were also widely expressed in these cell types. In cultures of nontransformed epithelial cells, lung fibroblasts, and airway smooth-muscle cells, IL-1beta (100 pg/ml) induced the rapid accumulation of LIF mRNA and protein release, with fibroblasts liberating the greatest amount. IL-6 also induced the expression of LIF mRNA and release of LIF in airway smooth-muscle cells, whereas exogenous LIF itself had no effect. Expression of LIFR mRNA was not influenced by exposure to IL-1beta or LIF in any of the cell lines used. These results highlight the widespread distribution and rapid release of LIF in human lung tissue and, in conjunction with our previous report, suggest that this cytokine may play an important role in lung inflammatory processes and neuroimmune interactions.

Bronchi↗

PubMed2004

Null leukemia inhibitory factor receptor (LIFR) mutations in Stuve-Wiedemann/Schwartz-Jampel type 2 syndrome.

Stuve-Wiedemann syndrome (SWS) is a severe autosomal recessive condition characterized by bowing of the long bones, with cortical thickening, flared metaphyses with coarsened trabecular pattern, camptodactyly, respiratory distress, feeding difficulties, and hyperthermic episodes responsible for early lethality. Clinical overlap with Schwartz-Jampel type 2 syndrome (SJS2) has suggested that SWS and SJS2 could be allelic disorders. Through studying a series of 19 families with SWS/SJS2, we have mapped the disease gene to chromosome 5p13.1 at locus D5S418 (Zmax=10.66 at theta =0) and have identified null mutations in the leukemia inhibitory factor receptor (LIFR or gp190 chain) gene. A total of 14 distinct mutations were identified in the 19 families. An identical frameshift insertion (653_654insT) was identified in families from the United Arab Emirates, suggesting a founder effect in that region. It is interesting that 12/14 mutations predicted premature termination of translation. Functional studies indicated that these mutations alter the stability of LIFR messenger RNA transcripts, resulting in the absence of the LIFR protein and in the impairment of the JAK/STAT3 signaling pathway in patient cells. We conclude, therefore, that SWS and SJS2 represent a single clinically and genetically homogeneous condition due to null mutations in the LIFR gene on chromosome 5p13.

Base Sequence↗

PubMed1995

Phosphorylation of the human leukemia inhibitory factor (LIF) receptor by mitogen-activated protein kinase and the regulation of LIF receptor function by heterologous receptor activation.

We used a bacterially expressed fusion protein containing the entire cytoplasmic domain of the human leukemia inhibitory factor (LIF) receptor to study its phosphorylation in response to LIF stimulation. The dose- and time-dependent relationships for phosphorylation of this construct in extracts of LIF-stimulated 3T3-L1 cells were superimposable with those for the stimulation of mitogen-activated protein kinase (MAPK). Indeed, phosphorylation of the cytoplasmic domain of the low-affinity LIF receptor alpha-subunit (LIFR) in Mono Q-fractionated, LIF-stimulated 3T3-L1 extracts occurred only in those fractions containing activated MAPK; Ser-1044 served as the major phosphorylation site in the human LIFR for MAPK both in agonist-stimulated 3T3-L1 lysates and by recombinant extracellular signal-regulated kinase 2 in vitro. Expression in rat H-35 hepatoma cells of LIFR or chimeric granulocyte-colony-stimulating factor receptor (G-CSFR)-LIFR mutants lacking Ser-1044 failed to affect cytokine-stimulated expression of a reporter gene under the control of the beta-fibrinogen gene promoter but eliminated the insulin-induced attenuation of cytokine-stimulated gene expression. Thus, our results identify the human LIFR as a substrate for MAPK and suggest a mechanism of heterologous receptor regulation of LIFR signaling occurring at Ser-1044.

3T3 Cells↗