PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “MafF Transcription Factor”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources
PubMed2005

Regulation of the MAFF transcription factor by proinflammatory cytokines in myometrial cells.

The MAF (proto-)oncogene family of basic-leucine zipper transcription factors plays crucial roles in the control of mammalian gene expression and development. Here we analyzed the regulation of the human MAFF gene, coding for a small MAF transcription factor, in uterine smooth muscle cells. We found that MAFF transcript levels are induced by proinflammatory cytokines in PHM1-31 myometrial cells. We observed an important induction by interleukin 1 beta (IL1B) and a weaker upregulation by tumor necrosis factor (TNF), whereas interleukin 6 (IL6) treatment had no effect. Time course experiments revealed a rapid induction of MAFF transcripts within 30 min following IL1B treatment. The presence of actinomycin D inhibited the upregulation, suggesting that regulation of MAFF mRNA levels occurs at the transcriptional level. We generated a MAFF-specific antiserum and determined that MAFF protein was also induced by TNF and IL1B in PHM1-31 cells. In contrast, it was particularly interesting that the transcript and protein levels of the highly homologous MAFG and MAFK genes are not modulated by these cytokines. Our results suggest a possible specific role for MAFF in proinflammatory cytokine-mediated control of myometrial gene expression and provide the first link between a small MAF transcription factor and the inflammatory response.

Cells, Cultured↗
PubMed2006

The novel human gene MIP functions as a co-activator of hMafF.

The human transcription factor MafF (hMafF) lacks a transactivation domain, it contains a heptad-leucine repeat motif (viz., Leu-zipper) that may mediate protein-protein interactions to regulate transcriptional activities. A protein with a coiled-coil domain encoded by a novel human gene (GenBank Accession No. AF289559) was found to interact with hMafF in vitro and in vivo and is designated as a MafF interacting protein (MIP). Here, we provide evidence that the coiled-coil domain of MIP is essential for binding to the Leu-zipper of hMafF and that the interaction between MIP and hMafF causes the translocalization of MIP from cytoplasm to nucleolus in HELA cells. We used a promoter-reporter system containing six tandem repeats of the US2 element, located in the promoter of the human oxytocin receptor gene and reported to bind specifically to hMafF, to understand effects on transcriptional activation of hMafF, and its interaction with MIP. Expression of hMafF or MIP alone did not alter basal reporter transcription activity, whereas co-expression of hMafF and MIP activated transcription efficiently. Moreover, truncated MIP, still containing the coiled-coil domain, transactivated as well as the full-length MIP did, and highlighting that MIP acts as a co-activator of hMafF.

Amino Acid Sequence↗
PubMed1996

Small Maf proteins interact with the human transcription factor TCF11/Nrf1/LCR-F1.

The human TCF11 gene encodes a ubiquitously expressed bZIP transcription factor of the cap n' collar (CNC) domain family. It has a high sequence similarity to the erythroid-specific bZIP factor p45 NF-E2 in the CNC domain, which is involved in DNA binding. LCR-F1, a TCF11 isoform, is a more potent transcriptional activator than p45 NF-E2 in erythroid cells. We show here that the TCF11 protein interacts to form heterodimers with small Maf proteins, previously shown to dimerize with p45 NF-E2, ECH and Fos. Such heterodimerization significantly alters the DNA binding characteristics of TCF11. While TCF11 alone binds in vitro to the tandem NF-E2 site derived from 5' DNase hypersensitive site 2 in the beta-globin locus control region and to the single NF-E2 site in the porphobilinogen deaminase gene promoter, stronger binding is detected in the presence of small Maf proteins. Using antibodies, TCF11 isoforms bound to the single NF-E2 site were detected in K562 erythroid cell nuclear extracts. These findings place TCF11 as a good candidate for the proposed widely expressed factor(s) known to interact with small Maf proteins and bind NF-E2 sites in a sequence-specific manner resembling NF-E2.

Avian Proteins↗
PubMedDate not supplied

Cloning MafF by recognition site screening with the NFE2 tandem repeat of HS2: analysis of its role in globin and GCSl genes regulation.

The erythroid-specific enhancer within hypersensitivity site 2 (HS2) of the human beta-globin locus control region is required for high level globin gene expression. We used an oligonucleotide of the NF-E2 tandem repeat, within HS2, as recognition site probe to screen a K562 cDNA library for interacting transcription factors. A 2.3 kb full length cDNA encoding the b-zip transcription factor MafF was isolated. MafF can form both homodimers and high affinity heterodimers with Nrf1, Nrf2 and Nf-E2, three members of the CNC-bZip family. Despite obvious structural similarities with the other small Maf proteins, MafF differs in its tissue distribution and its inability to repress transcription when overexpressed as homodimer. In fact, in different cell lines and on different promoters (gamma-globin, beta-globin and glutamylcysteine synthetase genes) the MafF homodimers do not appreciably affect transcription of target promoters, whereas MafF/CNC member heterodimers act as weak transcriptional activators. Even though MafF was cloned using probes derived from the globin LCR, it is in the context of the GCSl promoter and in combination with Jun that MafF shows a rather distinct and specific regulatory role. These observations suggest that a complex network of small Maf and CNC-AP1 protein interactions might be involved in regulating transcription in diverse tissues or developmental stages.

Base Sequence↗
PubMed1997

The world according to Maf.

Maf family proteins are so named because of their structural similarity to the founding member, the oncoprotein v-Maf. The small Maf proteins (MafF, MafG and MafK), as do all family members, include a characteristic basic region linked to a leucine zipper (b-Zip) domain which mediate DNA binding and subunit dimerization respectively. The small Maf proteins form homodimers or heterodimers with other b-Zip proteins present in the cell and bind to Maf recognition elements (MARE) in DNA. Since they lack known transcriptional activation domains, the small Maf proteins function either as obligatory heterodimeric partner molecules with numerous large subunits, discussed below, or alternatively as homo- or heterodimeric transcriptional repressors. The three small Maf proteins are expressed in a number of overlapping tissues, but their expression profiles nonetheless appear to be under meticulous tissue- and developmental stage-specific control. The MARE bears a striking resemblance to the NF-E2 binding sequence. NF-E2 binding sites in the human beta-globin locus control region have been directly implicated as integral components in the circuitry required for eliciting changes in chromatin structure that precede globin gene activation. While the NF-E2 DNA sequence has been shown to be important for erythroid-specific gene regulation, a growing list of other genes may also be regulated through the same, or very similar, cis elements in non-erythroid cells. Taken together, these observations argue that comprehensive analysis of the activities of the small Maf proteins may provide a unique perspective for expanding our understanding of transcriptional regulation that can be elicited through interacting transcription factor networks.

Animals↗
PubMed2005

Genetic evidence that small maf proteins are essential for the activation of antioxidant response element-dependent genes.

While small Maf proteins have been suggested to be essential for the Nrf2-mediated activation of antioxidant response element (ARE)-dependent genes, the extent of their requirement remains to be fully documented. To address this issue, we generated mafG::mafF double-mutant mice possessing MafK as the single available small Maf. Induction of the NAD(P)H:quinone oxidoreductase 1 (NQO1) gene was significantly impaired in double-mutant mice treated with butylated hydroxyanisole, while other ARE-dependent genes were less affected. Similarly, in a keap1-null background, where many of the ARE-dependent genes are constitutively activated in an Nrf2-dependent manner, only a subset of ARE-dependent genes, including NQO1, were sensitive to a simultaneous deficiency in MafG and MafF. Examination of single and double small maf mutant cells revealed that MafK also contributes to the induction of ARE-dependent genes. To obtain decisive evidence, we established mafG::mafK::mafF triple-mutant fibroblasts that completely lack small Mafs and turned out to be highly susceptible to oxidative stress. We found that induction in response to diethyl maleate was abolished in a wider range of ARE-dependent genes in the triple-mutant cells. These data explicitly demonstrate that small Mafs play critical roles in the inducible expression of a significant portion of ARE-dependent genes.

Adaptor Proteins, Signal Transducing↗
PubMedDate not supplied

Induction of endogenous Nrf2/small maf heterodimers by arsenic-mediated stress in placental choriocarcinoma cells.

Exposure to inorganic arsenic has been associated with various forms of cancer, nervous system pathogenesis, and vascular diseases, as well as reproductive and developmental toxicity. Here, the effect of inorganic arsenic on placental JAR choriocarcinoma cells was assessed. The nuclear protein levels of the CNC transcription factor Nrf2 were strongly induced in the presence of arsenic. Dosage response experiments showed that 0.5 microM of arsenic is sufficient to augment Nrf2 levels. The expression of the Nrf2 dimerization partners MafG and MafK appeared not to be modulated by arsenic, whereas MafF protein levels were slightly increased. Arsenic also induced the binding of endogenous Nrf2/small Maf DNA-binding complexes to a stress response element (StRE) recognition site. In addition, arsenic caused oxidative stress in the choriocarcinoma cell model as evidenced by an increase in intracellular H2O2 levels. Expression of the enzyme heme oxygenase-1 (HO-1), a known Nrf2 target gene, was upregulated by exposure of JAR cells to arsenic. These results suggest that Nrf2/small Maf heterodimers may play an important role in the response to arsenic-mediated stress in placental cells.

Arsenic↗
PubMed2004

Comparison of maf gene expression patterns during chick embryo development.

Maf proteins are basic-leucine zipper transcription factors belonging to the AP1 superfamily. Several developmental processes require Maf proteins yet, the redundancy or complementarity of their respective roles in common processes has been only partially investigated. We present for the first time a complete comparative analysis of maf gene expression patterns in vertebrates. Expression of c-maf, mafB/kreisler, mafA/L-maf, mafF, mafG and mafK was analyzed by whole-mount in situ hybridization within chick embryos and their extraembryonic tissues ranging from embryonic day (E) 1 to 7. We carefully examined the extent of overlap between distinct maf genes and report that the developing lens, kidney, pancreas and apoptotic zones of limb buds show sustained co-expression of large maf genes. Small maf genes also exhibit overlap, for example in the dermomyotome. We also describe so far unidentified sites of maf gene expression. mafA is found in the developing neural tube and dorsal root ganglia. c-maf hybridization is detected in the neuroretina, the notochord and the endothelium of extraembryonic blood vessels.

Animals↗
PubMed1999

Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.

Amino Acid Sequence↗
PubMed2002

Differential induction of mafF, mafG and mafK expression by electrophile-response-element activators.

The three small Maf proteins, MafF, MafG and MafK, have been implicated in a number of physiological processes, including development, differentiation, haematopoiesis and stress response. Here we report the constitutive expression of mafF, mafG and mafK in six human cell lines derived from various tissues (HepG2, IMR-32, K-562, HEK-293, RD and A549). The expression patterns of mafF, mafG and mafK varied widely among cell lines. Because small Maf proteins have been implicated in electrophile response element (EpRE)-mediated stress response, the ability of three EpRE activators [pyrrolidinedithiocarbamate (PDTC), phenylethyl isothiocyanate (PEITC) and t-butylhydroquinone (tBHQ)] to induce small Maf expression was examined in detail in HepG2 cells. Both PDTC and PEITC induced mafF, mafG and mafK expression, whereas tBHQ failed to markedly induce any of the three small Mafs. Where a response was observed, mafF was induced to the greatest extent compared with mafG and mafK, and this response was transcriptionally mediated. PDTC also induced small Maf expression in the other cell lines examined, with patterns of induction varying among cell lines. The differences in expression among the cell lines examined, coupled with the induction patterns observed, indicate that the three small maf genes are stress-responsive, but may be regulated via differing mechanisms. Furthermore, the fact that tBHQ, PDTC and PEITC induce EpRE activity, but that tBHQ fails to markedly induce any of the small Mafs, suggests that up-regulation of small Mafs is not an absolute requirement for EpRE-mediated gene expression.

Base Sequence↗
PubMed1999

Characterization of the murine mafF gene.

Small Maf proteins are obligatory heterodimeric partner molecules of mammalian Cap'n'Collar proteins that together control a wide variety of eukaryotic genes. Although both MafK and MafG are expressed in overlapping but distinct tissue distribution patterns during embryonic development, the physiological consequences of loss-of-function mutations in either gene are modest. This suggested that compensation by the third small Maf protein, MafF, might be a major reason for such mild phenotypes and that further analysis of MafF might therefore provide important insights for understanding small Maf regulatory function(s). We therefore cloned, mapped, transcriptionally and developmentally characterized, and finally disrupted the mafF gene. We show that murine mafF is transcriptionally regulated by three different promoters and is most abundantly expressed in the lung. The lacZ gene inserted into the mafF locus revealed prominent expression sites in the gut, lung, liver, outflow tract of the heart, cartilage, bone membrane, and skin but not in hematopoietic cells at any developmental stage. Homozygous mafF null mutant mice were born in a normal Mendelian ratio and displayed no obvious functional deficiencies, indicating that MafF activity may be dispensable even in tissues where the expression of other small Maf proteins is quite low.

Amino Acid Sequence↗
PubMed1993

Two new members of the maf oncogene family, mafK and mafF, encode nuclear b-Zip proteins lacking putative trans-activator domain.

The v-maf oncogene of the avian musculoaponeurotic fibrosarcoma virus, AS42, encodes a nuclear protein which contains a characteristic b-Zip domain. By screening a chicken embryo fibroblast (CEF) cDNA library under moderately stringent hybridization conditions, we picked up a series of cDNA clones for a novel maf-related gene which we named mafK. We also identified another maf-related gene named mafF by screening a chicken genomic library using a mafK probe. Structural analyses suggested that the mafK and mafF genes consist of three exons. The exon-intron structures of the two genes resemble each other, but differ from that of the chicken c-maf gene. As compared to the c-Maf protein, the proteins encoded by the mafK and the mafF genes are rather small in size and lack the regions corresponding to the amino terminal acidic domain present in the c-Maf protein. On the other hand, the structures of the b-Zip domain are well conserved among these Maf-related proteins. When overexpressed by using an avian retroviral vector, the two maf-related genes did not induce morphological transformation of CEF cells but induced colony formation in soft agar with very low efficiencies. With a specific antibody, the MafK protein was detected predominantly in the nuclei of the cells infected with the virus which carries the mafK gene. Tissue distributions of these three maf-family genes are different from one another, probably reflecting their different functions in vivo.

Amino Acid Sequence↗
PubMed2000

Expression of the bZIP transcription factor TCF11 and its potential dimerization partners during development.

TCF11 (also known as Nrf1 and LCR-F1) is a basic-region leucine-zipper (b-ZIP) transcription factor that is essential during embryonic development. We have carried out expression analysis at a number of developmental stages and find that while there is some localized elevated expression between 8 and 9 days post coitum (dpc), the gene is widely expressed with a constant level of mRNA transcripts detectable in all tissues and at all stages examined. However, this does not reflect the specific nature of a TCF11 mutant phenotype (EMBO J. 17 (1998) 1779) which shows an essential role in foetal liver haematopoiesis. The specificity of TCF11 function may be controlled at a post-transcriptional level including availability of, and specific interaction with, a range of potential heterodimerization partners. We therefore carried out expression analysis of four candidate partner molecules; the three small Maf genes and another bZIP transcription factor found to bind to TCF11 in a two-hybrid screen, ATF4. We show different patterns of expression for the three Maf genes during development with MafG being widely expressed, MafK expressed only later in development and in specific tissues, and no detection of MafF. ATF4 shows evidence of complex regulation during development and shows elevated expression in many of the same sites as TCF11.

Activating Transcription Factor 4↗
PubMed1996

Bach proteins belong to a novel family of BTB-basic leucine zipper transcription factors that interact with MafK and regulate transcription through the NF-E2 site.

Members of the small Maf family (MafK, MafF, and MafG) are basic region leucine zipper (bZip) proteins that can function as transcriptional activators or repressors. The dimer compositions of their DNA binding forms determine whether the small Maf family proteins activate or repress transcription. Using a yeast two-hybrid screen with a GAL4-MafK fusion protein, we have identified two novel bZip transcription factors, Bach1 and Bach2, as heterodimerization partners of MafK. In addition to a Cap'n'collar-type bZip domain, these Bach proteins possess a BTB domain which is a protein interaction motif; Bach1 and Bach2 show significant similarity to each other in these regions but are otherwise divergent. Whereas expression of Bach1 appears ubiquitous, that of Bach2 is restricted to monocytes and neuronal cells. Bach proteins bind in vitro to NF-E2 binding sites, recognition elements for the hematopoietic transcription factor NF-E2, by forming heterodimers with MafK. Furthermore, a DNA binding complex that contained MafK as well as Bach2 or a protein related closely to Bach2 was found to be present in mouse brain cells. Bach1 and Bach2 function as transcription repressors in transfection assays using fibroblast cells, but they function as a transcriptional activator and repressor, respectively, in cultured erythroid cells. The results suggest that members of the Bach family play important roles in coordinating transcription activation and repression by MafK.

Amino Acid Sequence↗
PubMed2004

Small Maf proteins serve as transcriptional cofactors for keratinocyte differentiation in the Keap1-Nrf2 regulatory pathway.

The small Maf proteins, MafF, MafG, and MafK, possess a leucine zipper (Zip) domain that is required for homodimer or heterodimer complex formation with other bZip transcription factors. In this study we sought to determine the identity of the specific constituent that collaboratively interacts with Nrf2 to bind to the Maf recognition element in vivo. Studies in vitro suggested that Nrf2 forms heterodimers with small Maf proteins and then bind to Maf recognition elements, but the bona fide partner molecules supporting Nrf2 activity in vivo have not been definitively identified. Nrf2 activity is usually suppressed by a cytoplasmic repressor, Keap1, so disruption of the keap1 gene causes constitutive activation of Nrf2. Nrf2 hyperactivity results in hyperproliferation of keratinocytes in the esophagus and forestomach leading to perinatal lethality. However, simultaneous disruption of nrf2 rescued keap1-null mice from the lethality. We exploited this system to investigate whether small Mafs are required for Nrf2 function. We generated keap1 and small maf compound mutant mice and examined whether keratinocyte abnormalities persisted in these animals. The data show that loss of mafG and mafF in the keap1-null mice reversed the lethal keratinocyte dysfunction and rescued the keap1-null mutant mice from perinatal lethality. This rescue phenotype of mafG::mafF::keap1 triple compound mutant mice phenocopies that of the nrf2::keap1 compound mutant mice, indicating that the small Maf proteins MafG and MafF must functionally cooperate with Nrf2 in vivo.

Adaptor Proteins, Signal Transducing↗
PubMed1995

Small Maf proteins heterodimerize with Fos and may act as competitive repressors of the NF-E2 transcription factor.

The maf oncogene encodes a bZip nuclear protein which recognizes sequences related to an AP-1 site either as a homodimer or as heterodimers with Fos and Jun. We describe here a novel maf-related gene, mafG, which shows extensive homology with two other maf-related genes, mafK and mafF. These three maf-related genes encode small basic-leucine zipper proteins lacking the trans-activator domain of v-Maf. Bacterially expressed small Maf proteins bind to DNA as homodimers with a sequence recognition profile that is virtually identical to that of v-Maf. As we have previously described, the three small Maf proteins also dimerize with the large subunit of NF-E2 (p45) to form an erythroid cell-specific transcription factor, NF-E2, which has distinct DNA-binding specificity. This study shows that the small Maf proteins can also dimerize among themselves and with Fos and a newly identified p45-related molecule (Ech) but not with v-Maf or Jun. Although the small Maf proteins preferentially recognize the consensus NF-E2 sequence as heterodimers with either NF-E2 p45, Ech, or Fos, these heterodimers seemed to be different in their transactivation potentials. Coexpression of Fos and small Mafs could not activate a promoter with tandem repeats of the NF-E2 site. These results raise the possibility that tissue-specific gene expression and differentiation of erythroid cells are regulated by competition among Fos, NF-E2 p45, and Ech for small Maf proteins and for binding sites.

Amino Acid Sequence↗
PubMed1996

Oxidative stress induces the levels of a MafG homolog in hamster HA-1 cells.

The Maf family encodes nuclear proteins that recognize AP-1-like response elements. MafB, MafK, MafF, and MafG, are all able to heterodimerize with each other, c-fos, and erythroid cell-specific transcription factor NF-E2, to affect the transcription of target genes. Using the technique of differential display, we recently identified a new oxidant-inducible mRNA, designated adapt66, in HA-1 hamster fibroblasts. Cloning, partial sequencing, and GenBank analysis of adapt66 revealed strong homology to chicken mafG, a newly identified member of the maf oncogene family. The mafG homolog/adapt66 mRNA induction appeared to be dependent upon calcium; occurred as early as 90 minutes following exposure of HA-1 cells to hydrogen peroxide; and peaked between 5 and 10 hours after peroxide treatment. It has previously been demonstrated that several cellular transcription factors, including Fos, can be induced by oxidative stress. The induction of the DNA binding sequence mafG homolog/adapt66 by hydrogen peroxide, and it's known interaction with c-fos, may represent important mechanisms by which oxidative stress can modulate gene expression.

Animals↗