SEARCH · PubMed Health

Results for “Protozoan Proteins”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗

PubMed2025

Widespread release of translational repression across Plasmodium's host-to-vector transmission event.

Malaria parasites must respond quickly to environmental changes, including during their transmission between mammalian and mosquito hosts. Therefore, female gametocytes proactively produce and translationally repress mRNAs that encode essential proteins that the zygote requires to establish a new infection. While the release of translational repression of individual mRNAs has been documented, the details of the global release of translational repression have not. Moreover, changes in the spatial arrangement and composition of the DOZI/CITH/ALBA complex that contribute to translational control are also not known. Therefore, we have conducted the first quantitative, comparative transcriptomics and DIA-MS proteomics of Plasmodium parasites across the host-to-vector transmission event to document the global release of translational repression. Using female gametocytes and zygotes of P. yoelii, we found that ~200 transcripts are released for translation soon after fertilization, including those encoding essential functions. Moreover, we identified that many transcripts remain repressed beyond this point. TurboID-based proximity proteomics of the DOZI/CITH/ALBA regulatory complex revealed substantial spatial and/or compositional changes across this transmission event, which are consistent with recent, paradigm-shifting models of translational control. Together, these data provide a model for the essential translational control mechanisms that promote Plasmodium's efficient transmission from mammalian host to mosquito vector.

Animals↗

PubMed2026

Plasmodium knowlesi can adapt to infect Duffy-negative erythrocytes.

Plasmodium knowlesi, a zoonotic malaria species, has become a significant public health concern in Southeast Asia. In regions such as Malaysia and southern Thailand, P knowlesi incidence has risen, even as other human malaria parasites are nearing elimination. Similar to its close relative Plasmodium vivax, P knowlesi relies on the Duffy antigen receptor for chemokine (DARC) as a key receptor for erythrocyte invasion. Only Duffy-positive individuals are thought to be susceptible to clinical infection. Here, we demonstrate that P knowlesi possesses greater invasion plasticity than previously recognized. This parasite can bypass the need for DARC, as shown by its in vitro adaptation to invade and replicate within Duffy-negative (Fy-) erythrocytes. This adaptation is stable and independent of DARC binding, enabling the adapted parasite line to be maintained in Fy- erythrocytes and to resist inhibition by α-DARC antibodies. Genomic analysis identified a genomic recombination event between the parasite's dbpα and dbpγ genes, resulting in a new chimeric gene dbpαγ. Using CRISPR-Cas9 targeted reversion, we could demonstrate that dbpαγ is essential for invasion of Fy- erythrocytes. These findings shed new light on the invasion plasticity of P knowlesi, with implications for the parasite's potential spread beyond Southeast Asia and for understanding the complex host-cell specificity and atypical invasion pathways seen in P vivax.

Plasmodium knowlesi↗

PubMed2022

High prevalence of Pfcrt 76T and Pfmdr1 N86 genotypes in malaria infected patients attending health facilities in East Shewa zone, Oromia Regional State, Ethiopia.

BACKGROUND: Plasmodium falciparum resistance to series of anti-malarial drugs is a major challenge in efforts to control and/or eliminate malaria globally. In 1998, following the widespread of chloroquine (CQ) resistant P. falciparum, Ethiopia switched from CQ to sulfadoxine-pyrimethamine (SP) and subsequently in 2004 from SP to artemether-lumefantrine (AL) for the treatment of uncomplicated falciparum malaria. Data on the prevalence of CQ resistance markers after more than two decades of its removal is important to map the selection pressure behind the targets codons of interest. The present study was conducted to determine the prevalence of mutations in Pfcrt K76T and Pfmdr1 N86Y codons among malaria-infected patients from Adama, Olenchiti and Metehara sites of East Shewa zone, Oromia Regional State, Ethiopia. METHODS: Finger-prick whole blood samples were collected on 3MM Whatman ® filter papers from a total of 121 microscopically confirmed P. falciparum infected patients. Extraction of parasite DNA was done by Chelex-100 method from dried blood spot (DBS). Genomic DNA template was used to amplify Pfcrt K76T and Pfmdr1 N86Y codons by nested PCR. Nested PCR products were subjected to Artherobacter protophormiae-I (APoI) restriction enzyme digestion to determine mutations at codons 76 and 86 of Pfcrt and Pfmdr1 genes, respectively. RESULTS: Of 83 P. falciparum isolates successfully genotyped for Pfcrt K76T, 91.6% carried the mutant genotypes (76T). The prevalence of Pfcrt 76T was 95.7%, 92.5% and 84.5% in Adama, Metehara and Olenchiti, respectively. The prevalence of Pfcrt 76T mutations in three of the study sites showed no statistical significance difference (χ2 = 1.895; P = 0.388). On the other hand, of the 80 P. falciparum samples successfully amplified for Pfmdr1, all carried the wild-type genotypes (Pfmdr1 N86). CONCLUSION: Although CQ officially has been ceased for the treatment of falciparum malaria for more than two decades in Ethiopia, greater proportions of P. falciparum clinical isolates circulating in the study areas carry the mutant 76T genotypes indicating the presence of indirect CQ pressure in the country. However, the return of Pfmdr1 N86 wild-type allele may be favoured by the use of AL for the treatment of uncomplicated falciparum malaria.

Antimalarials↗

PubMed2026

Signal recognition particle 14 binds to importin α in Plasmodium falciparum.

BACKGROUND: The eukaryotic signal recognition particle (SRP) consists of six proteins and one SRP RNA. This ribonucleoprotein complex assembles inside the nucleus. Nucleocytoplasmic transport is an essential process for the biogenesis of signal recognition particles (SRPs) as well as for the survival of a cell. There are studies on cells that indicate the import receptor is responsible for import of SRP proteins into nucleus, but there is a lack of evidence that SRP proteins directly bind with import receptors. METHODS AND RESULTS: Coding sequences of SRP 14 and importin α were amplified from synthesized cDNA and genomic DNA, respectively, of Plasmodium falciparum cultivated in vitro culture. The amplified products were cloned and expressed in E. coli, followed by purification. A binding study was conducted on glutathione-agarose as well as in a 96-well plate format at different concentrations of SRP 14 with immobilized importin α. CONCLUSION: This is the first report of direct binding between importin α and a eukaryotic signal recognition particle 14 (SRP 14). A cost-effective 96-well plate-based assay has also been developed to study the binding of cargoes of importin α.

Plasmodium falciparum↗

PubMed2008

Isolation and characterization of Plasmodium falciparum UAP56 homolog: evidence for the coupling of RNA binding and splicing activity by site-directed mutations.

UAP56 (U2AF65 associated protein) is a member of the DEAD-box helicase family. Helicases are essential enzymes generally involved in the metabolism of nucleic acids. The gene encoding a member of DEAD-box family was cloned and characterized from the human malaria parasite Plasmodium falciparum. PfU52 is homologous to UAP56 and contains the RNA-dependent ATPase, RNA helicase and RNA binding activities. Using the parasite extract we report that PfU52 is involved in splicing reaction. Site-directed mutagenesis studies indicate that the conserved residues glycine 181, isoleucine 182 and arginine 206 are involved in RNA binding and this activity is required for the enzymatic activities of PfU52. PfU52 is expressed in all the intraerythrocytic developmental stages of the parasite. In the present study we have reported the detailed characterization of PfU52 from P. falciparum and these results advance the knowledge regarding the function of UAP56 in general.

Adenosine Triphosphatases↗

PubMed2025

Trypanosomatid histones: the building blocks of the epigenetic code of highly divergent eukaryotes.

Histones play a fundamental role in eukaryotic organisms not only as scaffolding proteins in DNA packaging but also in regulating gene expression. They constitute the protein reel around which DNA wraps forming nucleosomes. This initial packing gives rise to the chromatin fiber which is next folded into three-dimensional arrangements. Additionally, histones have expanded their functions through the emergence of histone variants which have specialized purposes and can deeply affect chromatin organization and dynamics. Moreover, both canonical histones and histone variants comprise the building blocks of the histone code by being targets of different post-translational modifications (PTMs) that occur in a highly regulated manner both in place and time. Most of the above-mentioned about chromatin organization is conserved among eukaryotes. However, trypanosomatid histones have many peculiarities that entail a special description. In this review, we compile the current knowledge of canonical core histones, histone variants, and their PTMs in trypanosomatids. We highlight the similarities and differences between histone variants and their canonical counterparts in trypanosomatids, and we compare them with those from model organisms. Finally, we discuss the crosstalk between different histone marks and their genomic distribution underlying the uniqueness of trypanosomatids.

Histones↗

PubMed2025

Iron-mediated post-transcriptional regulation in Toxoplasma gondii.

Iron is required to support almost all life; however, levels must be carefully regulated to maintain homeostasis. Although the obligate parasite Toxoplasma gondii requires iron, how it responds upon iron limitation has not been investigated. Here, we show that iron depletion triggers significant transcriptional changes in the parasite, including in iron-dependent pathways. We find that a subset of T. gondii transcripts contain stem-loop structures, which have been associated with post-transcriptional iron-mediated regulation in other cellular systems. We validate one of these (found in the 3' UTR of TGME49_261720) using a reporter cell line. We show that the presence of the stem-loop-containing UTR is sufficient to confer accumulation at the transcript and protein levels under low iron. This response is dose and time-dependent and is specific for iron. The accumulation of transcript is likely driven by an increased reporter mRNA stability under low iron. Interestingly, we find iron-mediated changes in mRNA stability in around 400 genes. To examine the potential mechanism of this stability, we tested aconitase interaction with mRNA in low iron and found 43 enriched transcripts, but no specific interaction with our reporter UTR. However, the endogenous UTR led to maintenance of protein levels and increased survival of the parasite under low iron. Our data demonstrate the existence of iron-mediated post-transcriptional regulation in Toxoplasma for the first time; and suggests iron-mediated regulation may be important to the parasite in low iron environments.

Toxoplasma↗

PubMed2025

ves1α genes expression is the major determinant of Babesia bovis-infected erythrocytes cytoadhesion to endothelial cells.

Babesia bovis causes the most pathogenic form of babesiosis in cattle, resulting in high mortality in naive adults. This parasite invades red blood cells (RBCs) within the bovine hosts where they multiply and produce clinical disease. Babesia bovis exports numerous proteins into invaded RBCs changing its properties. Thus, the infected RBCs (iRBCs) are capable to cytoadhere in the microvasculature of internal organs and brain, leading to respiratory distress, neurologic signs, and mortality. Variant Erythrocyte Surface Antigen 1 (VESA1) is one of those exported proteins by B. bovis which represents a major virulence factor due to its central role in immune evasion by antigenic variation and intravascular parasite sequestration. VESA1 is a heterodimer protein encoded by ves1α and ves1β multigene family and localized on the ridges, the focal point for cytoadhesion. To gain further insights into the molecular mechanisms of cytoadhesion of B. bovis, we panned the parasites with bovine brain microvasculature endothelial cells, which resulted in obtaining several clones with different cytoadherence abilities. The transcriptome analysis of 2 high and 2 low cytoadherent clones revealed that ves1α sequences were diversified, likely resulting from genomic recombination. On the other hand, ves1β sequences were almost identical among these 4 clones. Insertion and expression of ves1α of a clone with high binding into ef-1α locus of a low binding clone increased cytoadherence confirming the role of ves1α suggested by our transcriptome data. Whole genome sequencing of cytoadherent clones revealed active locus of ves1 on chromosome 2. These results suggest that VESA1a proteins encoded by ves1α genes determine the cytoadherence strength of B. bovis and they are in the active site for recombination.

Animals↗

PubMed2025

Expanding kinetoplastid genome annotation through protein structure comparison.

Kinetoplastids belong to the Discoba supergroup, an early divergent eukaryotic clade. Although the amount of genomic information on these parasites has grown substantially, assigning gene functions through traditional sequence-based homology methods remains challenging. Recently, significant advancements have been made in in-silico protein structure prediction and algorithms for rapid and precise large-scale protein structure comparisons. In this work, we developed a protein structure-based homology search pipeline (ASC, Annotation by Structural Comparisons) and applied it to transfer biological information to all kinetoplastid proteins available in TriTrypDB, the reference database for this lineage. Our pipeline enabled the assignment of structural similarity to a substantial portion of kinetoplastid proteins, improving current knowledge through annotation transfer. Additionally, we identified structural homologs for representatives of 6,700 uncharacterized proteins across 33 kinetoplastid species, proteins that could not be annotated using existing sequence-based tools and databases. As a result, this approach allowed us to infer potential biological information for a considerable number of kinetoplastid proteins. Among these, we identified structural homologs to ubiquitous eukaryotic proteins that are challenging to detect in kinetoplastid genomes through standard genome annotation pipelines. The results (KASC, Kinetoplastid Annotation by Structural Comparison) are openly accessible to the community at kasc.fcien.edu.uy through a user-friendly, gene-by-gene interface that enables visual inspection of the data.

Kinetoplastida↗

PubMed2025

Multi-criteria decision making and its application to in silico discovery of vaccine candidates for Toxoplasma gondii.

Vaccine discovery against eukaryotic parasites is not trivial and few exist. Reverse vaccinology is an in silico vaccine discovery approach, designed to identify vaccine candidates from the thousands of protein sequences encoded by a target genome. Previously, we produced the Vacceed bioinformatics pipeline for identification of parasite membrane and excreted/secreted proteins that were likely be exposed to the hosts immune system. More recently, we improved upon machine learning as the final decision-making process to identify parasite proteins that induce a protective response in an animal model. Subsequently, we combined Vacceed with metrics on B and T cell epitope types to produce a new in silico discovery workflow. In this study we extend this in silico workflow to the developability of proteins as vaccines by the incorporation of metrics on the physicochemical properties of proteins. To demonstrate this process, every Toxoplasma gondii protein was ranked in its capacity to provide exposure to the immune system (Vacceed exposure score), presence of epitopes and solubility characteristics by several multicriteria decision making (MCDM) tools (such as TOPSIS, VIKOR and MABAC). A consensus rank was subsequently generated from the results of these tools using a variety of aggregate ranking methods. Levels of uncertainty in the aggregate protein rankings was assessed by conformal interval prediction in association with a machine learning model. Several of the top ranked proteins identified by this approach were novel, uncharacterized membrane transporters or proteins associated with RNA metabolism. In conclusion, MCDM automated the decision making using well known algorithms while conformal prediction intervals varied significantly across the 8000+ proteins of T. gondii. Highly ranked proteins (e.g. the top 100) typically generated low prediction intervals, providing high levels of confidence in their ranks.

Toxoplasma↗

PubMed2004

Expression of a major surface protein of Trypanosoma brucei insect forms is controlled by the activity of mitochondrial enzymes.

In cycling between the mammalian host and the tsetse fly vector, trypanosomes undergo major changes in energy metabolism and surface coat composition. Early procyclic (insect) forms in the tsetse fly midgut are coated by glycoproteins known as EP and GPEET procyclins. EP expression continues in late procyclic forms, whereas GPEET is down-regulated. In culture, expression of GPEET is modulated by glycerol or glucose. Here, we demonstrate that a glycerol-responsive element of 25 nucleotides within the 3' untranslated region of GPEET mRNA also controls expression by glucose and during development in the fly. In trypanosomes, mitochondrial ATP is produced mainly by the acetate: succinate-CoA transferase/succinyl-CoA synthetase (ASCT) cycle, the citric acid cycle, and the cytochromes. Silencing of the pyruvate dehydrogenase or succinyl-CoA synthetase from the ASCT cycle by RNA interference induces reexpression of GPEET in late procyclic forms, whereas inhibition of the citric acid cycle or the cytochromes has no effect. In contrast, inhibition of the alternative oxidase, the second branch of the electron transport chain, with salicylhydroxamic acid overrides the effect of glucose or glycerol and causes a reduction in the level of GPEET mRNA. Our results reveal a new mechanism by which expression of a surface glycoprotein is controlled by the activity of mitochondrial enzymes.

3' Untranslated Regions↗

PubMed2025

RNG2 tethers the conoid to the apical polar ring in Toxoplasma gondii to enable parasite motility and invasion.

The conoid is a dynamic, tubulin-based structure conserved across the Apicomplexa that undergoes extrusion during egress, gliding motility, and invasion in Toxoplasma gondii. This organelle traverses the apical polar ring (APR) in response to calcium waves and plays a critical role in controlling parasite motility. While the actomyosin-dependent extrusion of the conoid is beginning to be elucidated, the mechanism by which it remains apically anchored to the APR is still unclear. RNG2, a protein localized to both the conoid and the APR, has emerged as a strong candidate for mediating this connection. Biochemical analysis revealed that RNG2 is an unstable protein, undergoing extensive proteolytic cleavage both in the parasite and in heterologous expression systems. Its biochemical properties, with the presence of large coiled-coil domains, likely facilitate the formation of concatenated assemblies, enabling RNG2 to serve as a dynamic and resilient bridge between the conoid and the APR. Using a combination of iterative ultrastructure expansion microscopy and immunoelectron microscopy, we confirmed the localization of RNG2 to the 22 tethering elements bridging the APR and the conoid. Conditional depletion of RNG2 led to the striking detachment of the intact conoid organelle from the APR, supporting an essential role for RNG2 as a tether. Cryo-electron tomography of conoid-less parasites revealed that, in the absence of RNG2, the apical vesicle remains anchored to the plasma membrane, while the rhoptries follow the detached conoid. Although RNG2 depletion only mildly reduces microneme secretion, the parasites are immotile and exhibit impaired rhoptry discharge, highlighting the critical role of proper conoid anchorage in motility and host cell invasion. Comprehensive mutagenesis of RNG2 identified distinct regions responsible for binding to the conoid and the APR, and demonstrated that the full-length, intact protein is essential for bridging these two structures and for its functional activity. Altogether, RNG2 emerges as a pivotal protein that ensures conoid functionality and coordination in Coccidia.

Toxoplasma↗

PubMed2025

Function and interactions of a protein bridge between the inner membrane complex and subpellicular microtubules in Toxoplasma gondii.

Toxoplasma gondii is an intracellular parasite that utilizes peripheral membrane and cytoskeletal structures for essential functions such as host cell invasion and replication. These include the inner membrane complex (IMC) and the underlying longitudinal subpellicular microtubules (SPMT) that provide support for the IMC and give the parasite its distinctive crescent shape. Although the IMC and SPMTs have been studied separately, the mechanisms linking these adjacent structures remain largely unknown. This study identifies a protein named IMT1 that localizes to the maternal IMC and SPMTs and appears to tether the IMC to the microtubules. We disrupt the IMT1 gene to assess function and then use deletion analyses and mutagenesis to reveal regions of the protein that are necessary for binding to the IMC cytoskeleton or SPMTs. Using proximity labeling, we identify candidate IMT1 interactors in the IMC or SPMTs. Exploration of these candidates reveals that the loss of IMT1 results in a dramatic reduction of the microtubule-associated protein TLAP2 and that IMT1 binds directly to the cytoskeletal IMC proteins IMC1, IMC18, and IMC24. Together, these interactions reveal a novel bridge that connects two key cytoskeletal structures and provides new insight into the organization of the structural backbone of T. gondii.

Toxoplasma↗

PubMed2024

A pyruvate transporter in the apicoplast of apicomplexan parasites.

Pyruvate lies at a pivotal node of carbon metabolism in eukaryotes. It is involved in diverse metabolic pathways in multiple organelles, and its interorganelle shuttling is crucial for cell fitness. Many apicomplexan parasites harbor a unique organelle called the apicoplast that houses metabolic pathways like fatty acid and isoprenoid precursor biosyntheses, requiring pyruvate as a substrate. However, how pyruvate is supplied in the apicoplast remains enigmatic. Here, deploying the zoonotic parasite Toxoplasma gondii as a model apicomplexan, we identified two proteins residing in the apicoplast membranes that together constitute a functional apicoplast pyruvate carrier (APC) to mediate the import of cytosolic pyruvate. Depletion of APC results in reduced activities of metabolic pathways in the apicoplast and impaired integrity of this organelle, leading to parasite growth arrest. APC is a pyruvate transporter in diverse apicomplexan parasites, suggesting a common strategy for pyruvate acquisition by the apicoplast in these clinically relevant intracellular pathogens.

Apicoplasts↗

PubMed2025

The impact of Iso-mukaadial acetate on Plasmodium falciparum transcriptional gene regulation.

Malaria remains prevalent globally despite various intervention strategies aimed at preventing its transmission. With the decreasing effectiveness of antimalarial drugs, medicinal plant extracts have been proposed as alternatives. Iso-mukaadial acetate extracted from Warburgia salutaris has shown anti-plasmodial activity, but the mechanism of inhibition is unknown. In this study, RNA sequencing analysis of P. falciparum NF54 strain treated with IMA was conducted to determine the possible targets of IMA. The expression profiles of P. falciparum genes regulated by IMA and chloroquine (antimalarial control) during the intraerythrocytic stage were analyzed with gene ontology tools, including PlasmoDB, ShinyGO and g: Profiler. IMA and chloroquine upregulated genes linked to parasite biological processes and cell adhesion molecular binding functions, including PfEMP1, RIFIN, and STEVOR. Chloroquine specifically downregulated DNA replication processes involving DNA replication licensing factors MCM3 and DNA helicase, while IMA downregulated peptidyl-proline modification and glycolytic pathways. KEGG analysis suggested glycolysis-gluconeogenesis and pentose phosphate pathway enzymes (e.g., glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and glucose-6-phosphate dehydrogenase (G6PD)-6-phosphogluconolactonase) as theoretical IMA targets, whose suppression could hypothetically reduce ATP and NADPH production, weakening parasite energy supply and antioxidant defenses. The inhibition of DNA replication components (MCM complex, DNA topoisomerases) by IMA, and the downregulation of DNA replication/repair proteins by chloroquine, may both impair genome integrity, contributing to the observed anti-plasmodial effects. IMA treatment was assumed to be associated with impairment of parasite energy metabolism, redox balance and DNA replication machinery. These effects differ from chloroquine, which primarily targeted DNA replication and repair processes, yet both drugs upregulated adhesion-associated gene families. Changes in the expression of metabolic and replication genes induced by IMA suggest the compounds potential as an anti-plasmodial candidate, warranting further biochemical validation of its mechanism of effect.

Plasmodium falciparum↗

PubMed2025

Subcellular proteomics of the protist Paradiplonema papillatum reveals the digestive capacity of the cell membrane and the plasticity of peroxisomes across euglenozoans.

Diplonemids are among the most diverse and abundant protists in the deep ocean, have extremely complex and ancient cellular systems, and exhibit unique metabolic capacities. Despite this, we know very little about this major group of eukaryotes. To establish a model organism for comprehensive investigation, we performed subcellular proteomics on Paradiplonema papillatum and localized 4,870 proteins to 22 cellular compartments. We additionally confirmed the predicted location of several proteins by epitope tagging and fluorescence microscopy. To probe the metabolic capacities of P. papillatum, we explored the proteins predicted to the cell membrane compartment in our subcellular proteomics dataset. Our data revealed an accumulation of many carbohydrate-degrading enzymes (CDZymes). Our predictions suggest that these CDZymes are exposed to the extracellular space, supporting proposals that diplonemids may specialize in breaking down carbohydrates in plant and algal cell walls. Further exploration of carbohydrate metabolism revealed an evolutionary divergence in the function of glycosomes (modified peroxisomes) in diplonemids versus kinetoplastids. Our subcellular proteome provides a resource for future investigations into the unique cell biology of diplonemids.

Peroxisomes↗

PubMed2025

In silico identification of Leishmania GP63 protein epitopes to generate a new vaccine antigen against leishmaniasis.

BACKGROUND: The surface of Leishmania spp. presents glycoprotein 63 (GP63), a metalloprotease that acts as one of the parasite's major antigens. A vaccine against leishmaniasis has not yet been developed and stationary phase promastigotes have utmost importance in transmitting Leishmania spp. from phlebotomine sand fly to humans or reservoirs. Therefore, this study aimed to analyze GP63 protein in three different Leishmania spp. to determine new vaccine candidate antigen against leishmaniasis using sequencing data of locally detected Leishmania strains and in silico approaches. METHODOLOGY/PRINCIPAL FINDINGS: The GP63 protein sequences of the stationary phase/amastigote form of L. infantum, L. major, and L. tropica were identified and then the gene encoding GP63 protein in Leishmania positive samples (n:59) was amplified and sequenced for variation analysis. According to the results, 4, 6, 19 GP63 variants were found within L. infantum, L. major, and L. tropica isolates, respectively. The most prevalent variants within each species were selected for further analysis using in silico approaches. Accordingly, all selected GP63 proteins were antigenic and the amount of B and T cell epitopes were 23 for L. infantum, 10 for L. major, and 9 for L. tropica. The analysis of each epitope showed that all of them were non-toxic, non-allergen, and soluble but had different antigenicity values. Among these epitopes, EMEDQGSAGSAGS associated with L. major, STHDSGSTTC and AEDILTDEKRDILRK epitopes associated with L. infantum had the highest antigenicity values for B cell, MHC-I, and MHC-II epitopes, respectively. Moreover, conserved epitopes were detected among two or three Leishmania species. CONCLUSIONS/SIGNIFICANCE: This study detected many epitopes that could be used in vaccine studies and the development of serological diagnostic assays.

Antigens, Protozoan↗