SEARCH · PubMed Health

Results for “Response Elements”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed1993

Sequences in the rev-responsive element responsible for premature translational arrest in the human-immunodeficiency-virus-type-1 envelope.

Cell-free translation in the presence of pancreatic microsomal membranes of the full-length envelope transcript of the human immunodeficiency virus type 1 (HIV-1) yielded the expected extensively glycosylated and immunologically reactive gp160 envelope-protein precursor. In addition to this gp160, a shorter glycoprotein, which we designated gp120*, was produced due to a premature translation arrest. Utilizing kinetic experiments, pulse-chase analyses and various gp160 envelope RNA mutants, we demonstrated that the in-vitro-produced gp120* was not formed by cleavage of the gp160 precursor or by internal initiation of translation. A gp120 produced before gp160 synthesis was completed, and, independent of the gp160 proteolytic processing, has been shown to be produced and sequestered in the endoplasmic reticulum of HIV-1-infected cells [Willey, R. L., Klimkait, T., Frucht, D. M., Bonifacino, J. S. & Martin, M. A. (1991) Virology 184, 319-329]. The specific translational arrest shown to occur in vitro was found to be dependent on the Rev-responsive element, since deletion of this highly structured sequence abolished the production of gp120*. We found that the combination of two contiguous putative stem loops of the Rev-responsive element, located at nucleotides 7494-7522 and 7525-7550 of the HIV-1 Rev-responsive-element sequence, was responsible for the production of this truncated protein. To our knowledge, these stem-loop structures, distinct from that known to bind the Rev protein, represent the first example responsible for the production of alternative products by premature translational arrest in higher eukaryotes.

Base Sequence↗

PubMed1988

The iron-responsive element is the single element responsible for iron-dependent translational regulation of ferritin biosynthesis. Evidence for function as the binding site for a translational repressor.

Ferritin, a cytoplasmic protein critical in iron metabolism, displays iron-dependent regulation of its biosynthetic rate with no corresponding changes in mRNA levels. An iron-responsive element (IRE) has been identified in the 5'-untranslated region (UTR) of the human ferritin heavy chain mRNA which, when placed in the 5'-UTR of heterologous reporter genes, confers iron-dependent translational regulation to the hybrid mRNAs. However, whereas the biosynthetic rate of ferritin in response to changes in iron status exhibits a 30-80-fold range, the apparent ranges observed for reporter gene constructs utilizing chloramphenicol acetyltransferase assays or human growth hormone radioimmunoassays have been much less. A deletion and reconstitution study was undertaken to address the possibility that regions of the ferritin gene and mRNA other than the IRE may be necessary for the production of the full range of iron regulation. Data are presented that demonstrate that the IRE alone is capable of conferring iron-dependent translational regulation of biosynthesis to downstream encoded proteins that is both qualitatively and quantitatively similar to that observed with expression of ferritin itself. Thus, the complete range of iron-dependent translational regulation conferred by the IRE occurs independently of the presence of the ferritin promoter, other regions of the ferritin 5'-UTR, the ferritin coding region, and the ferritin 3'-UTR. Additionally, experiments addressing the translatability in vivo of various ferritin construct mRNAs support the theory that the IRE functions as the binding site for a translational repressor.

Binding Sites↗

PubMed2002

A novel deletion of the L-ferritin iron-responsive element responsible for severe hereditary hyperferritinaemia-cataract syndrome.

In the last few years, mutations that cause disease through increased efficiency of mRNA translation have been discovered. Hereditary hyperferritinaemia-cataract syndrome (HHCS) arises from various point mutations or deletions within the iron-responsive element (IRE) in the 5'-UTR of the L-ferritin mRNA. Each unique mutation confers a characteristic degree of hyperferritinaemia and severity of cataract in affected individuals. We report a novel six-nucleotide deletion identified in an Italian family presenting with elevated serum ferritin and early onset bilateral cataract. This deletion involves a sequence with a TCT repetition and may have occurred through a mechanism of slippage mispairing. Because of the above repetition, the observed mutation can be interpreted as deletion 22-27, 23-28, 24-29 or 25-30. Structural modelling predicted an IRE stem modification that is expected to markedly reduce the binding to iron-regulatory proteins. A double-gradient denaturing gradient gel electrophoresis (DG-DGGE) method easily detected the above deletion.

Adult↗

PubMed1998

Identification of the cis-acting endoplasmic reticulum stress response element responsible for transcriptional induction of mammalian glucose-regulated proteins. Involvement of basic leucine zipper transcription factors.

When unfolded proteins accumulate in the endoplasmic reticulum (ER), transcription of glucose-regulated proteins (GRPs) representing ER-resident molecular chaperones is markedly induced via the unfolded protein response (UPR) pathway. In contrast to recent progress in the analysis of yeast UPR, both cis-acting elements and transactivators responsible for mammalian UPR have remained obscure. Here, we analyzed the promoter regions of human GRP78, GRP94, and calreticulin genes and identified a novel element designated the ER stress response element (ERSE). ERSE, with a consensus of CCAATN9CCACG, was shown to be necessary and sufficient for induction of these GRPs. Using yeast one-hybrid screening, we isolated a human cDNA encoding a basic leucine zipper (bZIP) protein, ATF6, as a putative ERSE-binding protein. When overexpressed in HeLa cells, ATF6 enhanced transcription of GRP genes in an ERSE-dependent manner, whereas CREB-RP, another bZIP protein closely related to ATF6, specifically inhibited GRP induction. Endogenous ATF6 constitutively expressed as a 90-kDa protein was converted to a 50-kDa protein in ER-stressed cells, which appeared to be important for the cellular response to ER stress. These results suggest that, as in yeast, bZIP proteins are involved in mammalian UPR, acting through newly defined ERSE.

Amino Acid Sequence↗

PubMed1999

Induction of rat aldose reductase gene transcription is mediated through the cis-element, osmotic response element (ORE): increased synthesis and/or activation by phosphorylation of ORE-binding protein is a key step.

We isolated the rat aldose reductase gene and examined the 5'-flanking sequence for the presence of transcription regulatory element responsive to hyperosmolarity. Deletion of aldose reductase gene up to -1047 bp abolished the transcriptional activation in response to osmotic stimuli in transient transfection experiments. A 17-bp sequence [rat osmotic response element (rORE)], which is located in bp -1073/-1057 and contains the TGGAAAATCAC sequence, confers osmotic response on a heterologous promoter. Electrophoretic mobility shift assays using the 17-bp fragment demonstrated that distinct DNA-protein complexes (I and II) were formed predominantly with nuclear extracts from the cells exposed to hyperosmolarity. When the nuclear extracts were preincubated with calf intestinal alkaline phosphatase or protein phosphatase 1, formation of complexes I and II was reduced to the control level. However, incubation with protein tyrosine phosphatase and addition of antiphosphotyrosine antibody had no effect on the complexes. When the nuclear extracts were preincubated with diamide to oxidize the thiols, complexes I and II were not affected. Pretreatment of the cells with cycloheximide abolished the complexes. All of these data indicate that activation by phosphorylation and/or increased synthesis of rORE-binding protein(s) are the key steps in induction of transcription of the rat aldose reductase gene by hyperosmolarity. Furthermore, we showed that glucose was more effective than NaCl in induction of aldose reductase both in transient transfection experiments and by Northern blot analysis. The results suggest the presence of a glucose-specific mechanism of induction in addition to that by NaCl.

Aldehyde Reductase↗

PubMed1997

Dantrolene sodium reverses the increase in cAMP response element and TPA responsive element DNA-binding activity in the rabbit brain following haloperidol administration and heat stress.

Using electrophoretic mobility-shift assay (EMSA), we examined DNA-binding activity of cAMP response element (CRE), onto its responsive element CRE, as well as TPA responsive element (TRE) in the medial hypothalamus and striatum of the experimental rabbits administered with haloperidol under heat stress exposure and studied the effects of dantrolene sodium to the transcriptional factor. In EMSA with nuclear extracts from the rabbit brain, the DNA-binding activities of CRE and TRE in medial hypothalamus and striatum increased following haloperidol and heat stress. These increases were maintained by coadministration with atropine. The treatment with dantrolene sodium markedly reversed such increases. The alterations of activities of these transcriptional factors may reflect the therapeutic effect of dantrolene sodium.

Animals↗

PubMed1998

Overlapping antioxidant response element and PMA response element sequences mediate basal and beta-naphthoflavone-induced expression of the human gamma-glutamylcysteine synthetase catalytic subunit gene.

gamma-Glutamylcysteine synthetase (GCS), the rate-limiting enzyme in the de novo synthesis of GSH, is a heterodimer, consisting of a catalytic (GCSh) and a regulatory subunit (GCSl). We previously demonstrated that the constitutive and beta-naphthoflavone (beta-NF)-induced expression of the GCSh gene is mediated by a distal antioxidant response element (ARE), ARE4, located 3.1 kb upstream of the transcriptional start site [Mulcahy, Wartman, Bailey and Gipp (1997) J. Biol. Chem. 272, 7445-7454]. ARE4 consists of a consensus ARE sequence (5'-GTGACTCAGCG-3') containing an embedded PMA-responsive element (TRE, underlined). The relative significance of the two overlapping response elements to constitutive and beta-NF-induced expression of the GCSh gene was determined by mutational analyses. The internal activator protein-1 (AP-1)-binding sequence mediated constitutive expression of promoter/reporter transgenes, but was not required for beta-NF responsiveness. In gel-shift experiments, the TRE was necessary for binding of proteins from nuclear extracts prepared from untreated HepG2 cells. In contrast, induction by beta-NF was dependent on an intact ARE sequence, particularly the terminal GC box of ARE4. The GC box of ARE4 was shown to be essential for both basal and beta-NF-induced expression of reporter constructs. This element also influenced binding of nuclear proteins to ARE4, specifically in extracts isolated from beta-NF-treated HepG2 cells. Because previous studies indicated that ARE4 may co-operate with a separate putative ARE, the role of the neighbouring sequence (ARE3), located 34 bases downstream of ARE4, was also evaluated. Mutation of this element within a GCSh promoter/reporter did not modify the basal or beta-NF-induced expression of the transgene, demonstrating that ARE3 does not influence the constitutive or beta-NF-induced expression of the GCSh gene.

Antioxidants↗

PubMed2002

The transcriptional activation of the human copper/zinc superoxide dismutase gene by 2,3,7,8-tetrachlorodibenzo-p-dioxin through two different regulator sites, the antioxidant responsive element and xenobiotic responsive element.

Cu/Zn superoxide dismutase (SOD1) catalyzes the dismutation of superoxide radicals produced during biological oxidations and environmental stress. The most toxic dioxin, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), induces SOD1 in human liver cells. Deletion analyses showed that the promoter region between -400 and -239 was responsible for the induction, in which two different characteristic regulatory elements, the antioxidant responsive element (ARE) and xenobiotic responsive element (XRE), are located. When the cells transfected with the plasmid containing those two cis-elements, the transactivation of SOD1 promoter was about 4-fold by TCDD, whereas mutation either on the ARE or XRE elevated the promoter activity by about 2-fold. Functional analyses of these two elements by deletion, mutation in the natural context, heterologous promoter assay, and gel mobility shift assay supported the notion that the activation of the SOD1 promoter was induced by TCDD through these two regulatory elements ARE and XRE. These results alongside our previous data indicate that the induction of SOD1 in response to TCDD is mediated by either Nrf2 protein or Ah receptor protein through ARE and XRE, respectively. These results also imply that the SOD1 can be induced by dioxin either in combination with or independently of these two regulatory elements to effectively defend cells from oxidative stress.

Antioxidants↗

PubMedDate not supplied

Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

Alcohol Dehydrogenase↗

PubMed2001

Double-gradient denaturing gradient gel electrophoresis assay for identification of L-ferritin iron-responsive element mutations responsible for hereditary hyperferritinemia-cataract syndrome: identification of the new mutation C14G.

BACKGROUND: Hereditary hyperferritinemia-cataract syndrome is an autosomic dominant disorder caused by heterogeneous mutations on the iron-responsive element (IRE) of ferritin L-chain mRNA. The mutations described to date were identified by direct sequencing of DNA from probands with hyperferritinemia often associated to bilateral cataracts. A direct genetic approach on a large population is useful to recognize polymorphisms in the DNA region and the prevalence of mutations associated with minor increases in serum ferritin and subclinical cataracts. We developed a rapid DNA scanning technique to detect mutations in a single electrophoretic analysis. METHODS: The double-gradient denaturing gradient gel electrophoresis (DG-DGGE) method consisted of PCR amplification of the target genomic DNA with GC-clamped oligonucleotides. The sequence encoded the 5' untranslated flanking region of ferritin L-chain mRNA, which includes an IRE stem-loop structure. The product was subjected to DG-DGGE (8.5-15% polyacrylamide and 50-95% denaturant) to separate the homo- and heteroduplexes. RESULTS: The method clearly identified all eight accessible mutations, including C-G transversions, which are the most difficult to detect. The method was applied to scan DNA samples from 50 healthy subjects and from 230 subjects with serum ferritin >400 microg/L. The new mutation G14C was identified. CONCLUSIONS: The DG-DGGE method detects all the mutations in the L-ferritin IRE sequence, is rapid and economical, and can be applied to scan large populations. The first population study indicated that the mutations are rare and may involve regions of the IRE structure not yet characterized.

Base Sequence↗

PubMed1992

Overlap of the p53-responsive element and cAMP-responsive element in the enhancer of human T-cell leukemia virus type I.

The wild-type p53 protein suppresses transformation, but certain missense mutants of p53 can transform cells. Although the wild-type p53 protein contains a transcriptional activation domain, no p53-responsive element has been identified. Here, we identified the p53-responsive element within the Tax-responsive element [21-base-pair (bp) enhancer] of human T-cell leukemia virus type I. Mutation analysis of the 21-bp enhancer indicated that the 16-bp sequence containing the cAMP-responsive element and its surrounding sequence was responsible for p53-induced transactivation. This 16-bp sequence was demonstrated to bind specifically to wild-type human p53 protein in vitro. Using a series of deletion mutants of p53, we showed that almost the entire region of p53 is needed for the transactivating capacity. Furthermore, the transforming mutants of p53 were unable to act as transcriptional activators. The p53-responsive element identified here should be useful to analyze the mechanism by which p53 regulates expression of a set of genes with a negative effect on cellular growth.

Animals↗

PubMed1992

Isolation and characterization of a highly divergent HIV-2[GH-2]: generation of an infectious molecular clone and functional analysis of its rev-responsive element in response to primate retrovirus transactivators (Rev and Rex).

A highly divergent HIV-2 designated as HIV-2[GH-2] was obtained from an AIDS-related complex (ARC) patient in Ghana. A full-length molecular clone of this isolate was obtained and a biologically active clone was constructed. Its restriction pattern differed from that of prototype HIV-2[GH-1] in 25 of 35 restriction sites, but was strikingly similar to a previously characterized HIV-2 isolate from a Ghanaian (HIV-2ALT). The conserved integrase region (288-bp fragment) previously displayed 95% identity with that of ALT but 17-20% divergence from the HIV-2 prototype member, and a new distinct subgroup (HIV-2b) of HIV-2 consisting of GH-2 and ALT was postulated (Miura et al. 1991.) These isolates, however, were biologically distinguishable from each other by its replication capacity in a monocyte line, U937, in which GH-2 could not grow but ALT grew well. In addition, the nucleotide sequence of the LTR of this new isolate displays 21% divergence from that of prototype HIV-2[GH-1], but the core enhancer, Sp1 binding sites and TATA box were conserved. Although the 3' half of the env gene sequence which is deleted in HIV-2ALT clone showed 27% diversity from the prototype, functional differences in the rev-responsive element were not observed.

Cloning, Molecular↗

PubMed2006

Integrating iron and oxygen/antioxidant signals via a combinatorial array of DNA - (antioxidant response elements) and mRNA (iron responsive elements) sequences.

Fe (cellular iron), O (dioxygen, antioxidant inducers, hydrogen peroxide), and P (protein phosphorylation) signals combine to regulate DNA activity (transcription/mRNA synthesis) for antioxidant/Phase II response proteins (e.g., ferritin H, ferritin L, thioredoxin reductase I, NAD(P)H quinone oxido-reductase, heme oxygenase1 and beta-globin) and mRNA activity for proteins of iron transport, storage or oxygen metabolism (e.g., ferritin H, ferritin L, transferrin receptor1, ferroportin, mt-aconitase-TCA cycle and aminolevulinate synthase - heme biosynthesis). Ferritin regulation links the two groups of genetic controls via DNA (ARE-antioxidant response element) and mRNA (IRE-iron responsive element) structures. More is known about the IRE-mRNA and protein repressors, IRPs (iron regulatory proteins/aconitase homologues), than the DNA-ARE and protein repressors, e.g., Bach1. Iron responsive elements are very similar (65-80% sequence identity), but each mRNA has sufficient IRE specificity (>90% phylogenetic sequence conservation), that IRP binding and signal responses vary quantitatively. The structural specificity of each IRE-RNA provides an opportunity for finding small molecule regulators in vitro, and possibly in vivo. The potential of manipulating mRNA function with small molecules targeted to specific RNA regulatory structures, e.g., ferritin mRNA in iron overload, or viral mRNA control structures for replication, is high.

Antioxidants↗

PubMed1996

Identification and characterization of a versatile retinoid response element (retinoic acid receptor response element-retinoid X receptor response element) in the mouse tissue transglutaminase gene promoter.

Tissue transglutaminase (transglutaminase type II) is an intracellular protein cross-linking enzyme that accumulates in connective tissue and in cells undergoing apoptosis. Retinoids regulate the transcription of the mouse tissue transglutaminase gene via activation of regulatory elements contained within 4 kilobases of the 5'-end of the gene. Co-transfection studies with retinoid receptor expression vectors in CV-1 cells demonstrated that the mouse tissue transglutaminase promoter is activated by ligand activation of either retinoic acid receptor-retinoid X receptor (RAR.RXR) heterodimers or RXR homodimers. Optimal induction is achieved with retinoid receptor panagonists; partial activation can also be achieved with either RAR-specific or RXR-specific retinoids. Retinoid-dependent activation of the tissue transglutaminase promoter depends on both a proximal regulatory region containing sequences highly conserved between the human and the mouse tissue transglutaminase promoters and a distal region that includes a 30-base pair retinoid response element (mTGRRE1). mTGRRE1 contains three hexanucleotide half-sites (two canonical and one non-canonical) in a DR7/DR5 motif that bind both RAR*RXR heterodimers and RXR homodimers. These studies suggest that retinoid-dependent expression of the mouse tissue transglutaminase gene is mediated by a versatile tripartite retinoid response element located 1.7 kilobases upstream of the transcription start site.

3T3 Cells↗

PubMed1991

cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.

Abscisic Acid↗

PubMed1999

Serum response elements activate and cAMP responsive elements inhibit expression of transcription factor Egr-1 in synovial fibroblasts of rheumatoid arthritis patients.

Analyzing the induction kinetics and promoter elements regulating the expression of the transcription factor Egr-1, we found elevated levels of Egr-1-encoding mRNA in synovial fibroblasts of rheumatoid arthritis (RA) patients when compared to controls. By contrast, synovial lymphocytes and macrophages do not show an elevated Egr-1 transcription. Therefore, the overexpression of Egr-1 may serve as a diagnostic marker to characterize synovial fibroblasts of RA patients. To study the regulatory mechanisms controlling Egr-1 expression we analyzed the function of transcription factor binding sites located in the Egr-1 promoter. Individual transcription factor binding sites within the Egr-1 promoter were specifically mutated and Egr-1 promoter activity was tested using reporter gene constructs. Our experiments demonstrate that serum response elements are the main positive regulators and binding to a cAMP responsive element represents the major negative regulator for Egr-1 expression in synovial fibroblasts. In addition, we functionally defined a new element, which was not yet described in the human Egr-1 promoter and which serves as a second negative regulatory element for Egr-1 expression. Therefore increased serum response factor activity or failure of Egr-1 repressing signals may account for Egr-1 overexpression in RA synovial fibroblasts.

Arthritis, Rheumatoid↗

PubMed2005

Dexamethasone represses cAMP rapid upregulation of TRH gene transcription: identification of a composite glucocorticoid response element and a cAMP response element in TRH promoter.

Hypothalamic proTRH mRNA levels are rapidly increased (at 1 h) in vivo by cold exposure or suckling, and in vitro by 8Br-cAMP or glucocorticoids. The aim of this work was to study whether these effects occurred at the transcriptional level. Hypothalamic cells transfected with rat TRH promoter (-776/+85) linked to the luciferase reporter showed increased transcription by protein kinase (PK) A and PKC activators, or by dexamethasone (dex), but co-incubation with dex and 8Br-cAMP decreased their stimulatory effect (as observed for proTRH mRNA levels). These effects were also observed in NIH-3T3-transfected cells supporting a characteristic of TRH promoter and not of hypothalamic cells. Transcriptional regulation by 8Br-cAMP was mimicked by noradrenaline which increased proTRH mRNA levels, but not in the presence of dex. PKA inhibition by H89 avoided 8Br-cAMP or noradrenaline stimulation. TRH promoter sequences, cAMP response element (CRE)-like (-101/-94 and -59/-52) and glucocorticoid response element (GRE) half-site (-210/-205), were analyzed by electrophoretic mobility shift assays with nuclear extracts from hypothalamic or neuroblastoma cultures. PKA stimulation increased binding to CRE (-101/-94) but not to CRE (-59/-52); dex or 12-O-tetradecanoylphorbol-13-acetate (TPA) increased binding to GRE, a composite site flanked by a perfect and an imperfect activator protein (AP-1) site in the complementary strand. Interference was observed in the binding of CRE or GRE with nuclear extracts from cells co-incubated for 3 h with 8Br-cAMP and dex; from cells incubated for 1 h, only the binding to GRE showed interference. Rapid cross-talk of glucocorticoids with PKA signaling pathways regulating TRH transcription constitutes another example of neuroendocrine integration.

Animals↗

PubMedDate not supplied

Human DNA Polymerase-beta Promoter: Phorbol Ester Activation Is Mediated through the cAMP Response Element and cAMP-Response-Element-Binding Protein.

That mammalian DNA polymerase-beta (beta-pol) gene transcription is upregulated by activated ras and also by phorbol ester (TPA) treatment suggests the involvement of protein kinase C in the gene expression control for this DNA repair enzyme. Yet, the core promoters of the human, bovine and rodent beta-pol genes do not have a TPA response element or other binding site for the transcriptional activator AP-1. Instead, these beta-pol promoters appear to be regulated mainly by proteins binding to the cAMP response element (CRE) centered within 50 bp 5' of the transcriptional start site. In this study, the CRE in the human beta-pol promoter was found to mediate TPA upregulation of the cloned promoter in HeLa cell transient expression experiments. To further examine the role of this CRE in TPA stimulation, we used several mutated promoters that were either deficient in protein binding to the CRE or contained extra CRE sites arranged as tandem repeats. All constructs with at least one functional CRE were upregulated by TPA, whereas mutants lacking CRE protein-binding function were not TPA upregulated. Analyses of HeLa nuclear extract DNA-binding proteins indicated that the beta-pol CRE was bound by CRE-binding protein (CREB) family members CREB-1 and activating transcription factor-1, but not by AP-1 or complexes containg AP-1 subunits. These results suggest that CREB, rather than AP-1 proteins, are required for the CRE-mediated TPA activation of the beta-pol promoter.

Journal Article↗