SEARCH · PubMed Health

Results for “Stage shift”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed2026

Stage shift, histological differentiation, and survival patterns of lung squamous cell carcinoma versus adenocarcinoma in low-dose CT screening.

BACKGROUND: Whether LDCT-associated stage shift translates into similar survival patterns across lung cancer histologies remains uncertain. We compared stage shift, histological differentiation, tumor characteristics, and survival between lung squamous cell carcinoma (LUSC) and adenocarcinoma (LUAD) in the National Lung Screening Trial. METHODS: Among participants diagnosed with LUSC or LUAD, stage distribution and histological differentiation were compared between LDCT and chest X-ray (CXR) arms. Survival among diagnosed cases was measured from randomization. Multivariable models tested screening arm-by-histology interactions. Screen-detected LDCT tumors were compared by histology. RESULTS: During 6.5 years of median follow-up, 498 LUAD and 249 LUSC cases were diagnosed in the LDCT arm, and 374 and 212, respectively, were diagnosed in the CXR arm. LDCT was associated with higher odds of stage I disease for LUAD (adjusted odds ratio [aOR], 2.48; 95% CI 1.88-3.28) and LUSC (aOR, 1.71; 95% CI 1.17-2.48), without significant interaction (P = 0.116). LDCT was associated with lower hazard of lung cancer-specific death among diagnosed LUAD cases (adjusted hazard ratio [aHR], 0.54; 95% CI 0.43-0.66), but not among diagnosed LUSC cases (aHR, 1.04; 95% CI 0.78-1.39; P for interaction<0.001). LUSC had lower screening sensitivity, more frequent detection in annual screening rounds, greater prediagnostic tumor size increase, and fewer well-differentiated stage I tumors than LUAD. CONCLUSION: LDCT was associated with stage shift for both subtypes, but favorable survival patterns among diagnosed cases were mainly observed for LUAD. Lower screening sensitivity, greater prediagnostic tumor size increase, and poorer histological differentiation may help explain why stage shift did not translate into similar survival patterns for LUSC. TRIAL REGISTRATION: ClinicalTrials.gov, NCT00047385.

Humans↗

PubMed2025

The Application of Preventive Medicine in the Future Digital Health Era.

A number of seismic shifts are expected to reshape the future of medicine. The global population is rapidly aging, significantly impacting the global disease burden. Medicine is undergoing a paradigm shift, defining and diagnosing diseases at earlier stages and shifting the health care focus from treating diseases to preventing them. The application and purview of digital medicine are expected to broaden significantly. Furthermore, the COVID-19 pandemic has further accelerated the shift toward predictive, preventive, personalized, and participatory (P4) medicine, and has identified health care accessibility, affordability, and patient empowerment as core values in the future digital health era. This "left shift" toward preventive care is anticipated to redefine health care, emphasizing health promotion over disease treatment. In the future, the traditional triad of preventive medicine-primary, secondary, and tertiary prevention-will be realized with technologies such as genomics, artificial intelligence, bioengineering and wearable devices, and telemedicine. Breast cancer and diabetes serve as case studies to demonstrate how these technologies such as personalized risk assessment, artificial intelligence-assisted and app-based technologies, have been developed and commercialized to provide personalized preventive care, identifying those at a higher risk and providing instructions and interventions for healthier lifestyles and improved quality of life. Overall, preventive medicine and the use of advanced technology will hold great potential for improving health care outcomes in the future.

Humans↗

PubMed2026

Gut microbiota dynamics and metabolic pathways associated with bleomycin-induced pulmonary fibrosis progression.

BACKGROUND: Pulmonary fibrosis (PF) is a progressive respiratory disease characterized by epithelial injury, aberrant repair and excessive extracellular matrix deposition. Although the gut-lung axis is increasingly implicated in respiratory disorders, stage-resolved characterization of gut microbiota taxonomic and functional potential during PF development is limited. METHODS: We established a bleomycin-induced murine PF model and performed cross-sectional shotgun metagenomic sequencing of fecal samples from separate cohorts at three defined stages: baseline (control), day 7 (early fibrosis; M7), and day 14 (established fibrosis; M14). Microbial taxonomy, alpha/beta diversity, and predicted functional capacity were inferred using Kyoto Encyclopedia of Genes and Genomes (KEGG) and Carbohydrate-Active enZymes (CAZy) annotations; associations were assessed using Procrustes and Spearman correlation analyses. RESULTS: Histopathology and immunohistochemistry confirmed progressive fibrogenesis with increased TGF-β1 and α-SMA expression. Compared with baseline, bleomycin-treated groups exhibited stage-specific shifts in gut microbial composition, including depletion of mucin-associated taxa (e.g., Prevotella, Akkermansia muciniphila) and expansion of Muribaculaceae- and Clostridiaceae-affiliated taxa. Alpha and beta diversity metrics differed across groups. KEGG/CAZy-based annotations revealed predicted, stage-dependent changes in microbial metabolic potential, including early reductions in pathways related to amino acid and glycan metabolism (M7) and later increases in predicted starch/sucrose catabolism, phosphotransferase system (PTS) representation, and secondary bile acid biosynthesis (M14). Correlation analyses linked compositional shifts to these predicted functional changes. CONCLUSION: In a stage-resolved, cross-sectional study, bleomycin-associated pulmonary fibrosis was accompanied by compositional and predicted functional alterations in the gut microbiota. These data identify candidate taxa and predicted pathways for follow-up mechanistic testing, but functional (metabolomic) and causality experiments are required to confirm whether and how microbial changes contribute to PF pathogenesis.

Animals↗

PubMed2026

NAD+ Metabolism Licenses Zygotic Genome Activation via PARP7-Mediated ADP-Ribosylation of UHRF1 in Mouse Early Embryos.

Zygotic genome activation (ZGA) is a critical developmental milestone whose metabolic regulation remains unclear. This study identifies a pivotal role for Nicotinamide adenine dinucleotide (NAD+) metabolism in regulating ZGA through poly(ADP‑ribose) polymerase 7(PARP7)-mediated ADP-ribosylation. Using ultra-low input embryo metabolomics, we profiled metabolism from zygote to blastocyst, revealing a significant NAD+ decline at the 2-cell stage. This shift coincided with specific upregulation of the mono-ADP-ribosyltransferase PARP7, confirmed by transcriptomics, quantitative RT-PCR, western blot, and immunofluorescence. Genetic knockdown via trim-away technology or pharmacological inhibition with RBN-2397 caused developmental delay/arrest at the 2-cell stage, impaired blastocyst formation, and defective ZGA. Mechanistically, PARP7 deficiency reduced chromatin accessibility (ATAC-seq), diminished H3K4ac and H3K27ac marks, and impaired RNA polymerase II transcription. Integrated proteomics and ADP-ribosylome analysis of late 2-cell embryos identified UHRF1 as a key PARP7 target, mono-ADP-ribosylated at lysines K30 and K31. This modification stabilized UHRF1 protein (cycloheximide chase), and UHRF1 overexpression partially rescued the transcriptional defects associated with ZGA from PARP7 inhibition. Our findings establish a metabolic-epigenetic axis wherein NAD+ metabolism, via PARP7-mediated ADP-ribosylation of UHRF1, regulates chromatin remodeling and transcriptional activation during ZGA, offering fundamental insights into early development.

Animals↗

PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗

PubMed2026

Hepatic metabolic adaptation to endurance exercise: temporal and sex differences by multiomics integration and validation.

BACKGROUND: Although endurance exercise benefits liver health, sex-specific adaptive trajectories remain unclear. This study mapped dynamic liver adaptation in males and females during prolonged training and identified underlying molecular programs. METHODS: Using publicly available time-resolved liver multi-omics data generated by the Molecular Transducers of Physical Activity Consortium (MoTrPAC), we established a computational pipeline for differential analysis of transcriptomic, proteomic, phosphoproteomic, and metabolomic data with FDR correction, followed by FGSEA pathway enrichment. Kinase activities were inferred through ortholog mapping and PhosphoSitePlus. Cross-omics co-expression networks were constructed using WGCNA and topological overlap to link omics features with physiological phenotypes. For experimental validation, liver tissues were collected from endurance-trained Sprague-Dawley rats, and key nodes were confirmed by Western blotting, qRT-PCR, and immunofluorescence/immunohistochemical staining. Public scRNA-seq data were further integrated to map multi-omics signals to single-cell resolution and assess functional changes in specific cell types. RESULTS: The hepatic response to exercise stress was stage-specific, shifting from early transcriptional activation to later proteomic and metabolic remodeling. Multi-omics integration revealed distinct sex-associated adaptive trajectories: males were more strongly associated with energy metabolism, redox-related programs, and amino acid/organic acid catabolism, whereas females showed prominent membrane lipid remodeling, proteostasis -related programs, and mitochondrial/ribosomal translational features. Single-cell analysis showed that tissue remodeling occurred without major lineage turnover, instead involving altered communication among pre-existing cell communities. Validation of PPP1R3G identified a protein-dominant exercise-responsive marker, supporting the contribution of post-transcriptional or protein-level regulation. CONCLUSIONS: Hepatic adaptation to endurance stress follows a cross-omics evolutionary pattern with sex-specific reprogramming of energy supply and homeostatic maintenance. This time-resolved framework clarifies how exercise improves liver function and supports sex-oriented metabolic interventions and therapeutic target discovery.

Animals↗

PubMed2026

Differentiating hemorrhagic shock and organophosphate poisoning through integrated skin microbiome-metabolome signatures.

Accurate determination of cause of death and estimation of postmortem interval (PMI) are critical yet challenging tasks in forensic science, particularly in cases with rapid demise and absence of obvious morphological abnormalities. We employed an integrative multi-omics approach to characterize postmortem microbial succession and metabolic alterations on facial skin in mouse models of hemorrhagic shock (HS) and organophosphorus poisoning (OP) across three decomposition stages: bloating (2 days), active decay (8 days), and advanced decay (16 days). Metagenomic profiling revealed significantly reduced α-diversity in HS compared with OP throughout all stages (p < 0.001), accompanied by stage-dependent compositional shifts, including early enrichment of Firmicutes in HS and Proteobacteria in OP. A total of 237 differential taxa were identified, with Providencia and Morganella predominating in OP, whereas Staphylococcus and Corynebacterium dominated bloating stage of HS. Untargeted metabolomics uncovered distinct cause-of-death-linked metabolites, notably elevated 2'-deoxycytidine-5'-diphosphate in early OP and persistent cholic acid/cholate accumulation in HS at later PMI. Functional analysis highlighted histidine and phosphate/phosphonate metabolism as key discriminatory pathways, exhibiting stage-specific oscillations and strong correlations with characteristic taxa. These findings demonstrate that skin-based metagenomic-metabolomic integration provides robust, mechanistically informed biomarkers for both PMI estimation and cause-of-death differentiation, offering a minimally invasive and temporally dynamic tool for forensic investigations.

Animals↗

PubMed2026

NExON-Bayes: a Bayesian approach to network estimation informed by ordinal covariates.

MOTIVATION: In heterogeneous disease settings, accounting for intrinsic sample variability is crucial for obtaining reliable and interpretable omic network estimates. However, most graphical model analyses of biomedical data assume homogeneous conditional dependence structures, potentially leading to misleading conclusions. To address this, we propose a joint Gaussian graphical model that leverages sample-level ordinal covariates (e.g. disease stage) to account for heterogeneity and improve the estimation of partial correlation structures. RESULTS: Our modelling framework, called NExON-Bayes, extends the graphical spike-and-slab framework to account for ordinal covariates, jointly estimating their relevance to the graph structure and leveraging them to improve the accuracy of network estimation. To scale to high-dimensional omic settings, we develop an efficient variational inference algorithm tailored to our model. Through simulations, we demonstrate that our method outperforms the vanilla graphical spike-and-slab (with no covariate information), as well as other state-of-the-art network approaches which exploit covariate information. Applying our method to reverse phase protein array data from patients diagnosed with stage I, II or III breast carcinoma, we estimate the behaviour of proteomic networks as cancer progresses. Our model provides insights not only through inspection of the estimated proteomic networks, but also of the estimated ordinal covariate dependencies of key groups of proteins within those networks, offering a comprehensive understanding of how biological pathways shift across disease stages. AVAILABILITY AND IMPLEMENTATION: A user-friendly R package for NExON-Bayes with tutorials is available on Github at github.com/jf687/NExON, and archived at https://doi.org/10.5281/zenodo.20312938. The source of the dataset used is cited in the relevant section.

Bayes Theorem↗

PubMed2026

Maternal redd1 mRNA decline triggers mTORC1 activation during the blastula-gastrula transition in zebrafish embryos.

During early metazoan development, maternal mRNAs and proteins stored in the egg sustain initial cellular functions. After the blastula stage, developmental control shifts to zygotic gene expression, and maternal transcripts are progressively degraded. Although mTORC1 is a central regulator of global mRNA translation and cell growth, its role in controlling maternal mRNA translation prior to gastrulation remains poorly understood. In zebrafish embryos, the mTORC1 inhibitor redd1 is abundantly expressed after fertilization but decreases following the maternal-to-zygotic transition (MZT), inversely correlating with mTORC1 activity. Overexpression of redd1 suppresses mTORC1, impairs gastrulation, and reduces translation of 5'TOP mRNAs and key regulatory genes, underscoring the necessity of relieving mTORC1 inhibition after the blastula stage. To investigate redd1 translation under conditions of low mTORC1 activity, we injected reporter mRNAs containing its 5' and 3' UTRs. The 3'UTR promoted polyadenylation and enhanced translation, while both UTRs enabled efficient reporter expression despite mTORC1 suppression, indicating that redd1 mRNA is translated independently of canonical mTORC1 pathways. Similarly, maternal mRNAs such as nanog, myca, pou5f3, and ccnb1, as well as the early zygotic transcript dharma, are translated through mTORC1-independent mechanisms. Together, these findings reveal a transient phase of mTORC1 suppression in early zebrafish embryos and demonstrate that select maternal and zygotic mRNAs bypass this regulation to ensure proper developmental progression.

Animals↗

PubMed2026

A novel urease-producing strain effectively induces cadmium biomineralization under low-temperature stress.

Microbially induced carbonate precipitation (MICP) has been widely used to immobilize Cadmium (Cd) in contaminated soils in mining-affected regions. However, its remediation efficacy under low-temperature stress, as well as the nucleation process that regulates Cd biomineralization via carbonate precipitation by psychrophilic bacteria, has yet to be investigated. Here, we isolated Pseudomonas sp. J-6, a novel urease-producing strain from tailings in high-altitude cold regions, exhibiting unparalleled cold adaptability at 5 °C and achieving 95.85 % Cd removal efficiency by MICP at 10 °C. Furthermore, the coprecipitation process of Ca1-xCdxCO3 was clarified through the continuous observation of the precipitates after the low-temperature MICP reaction. The crystal morphology transitioned from loose vaterite in the early stage to a dense square-block morphology in the middle stage. Cd2+ progressively shifted from a surface-bound state to lattice incorporation, ultimately resulting in the formation of stable Cd-substituted calcite crystals. In this process, low temperatures led to the formation of larger, highly ordered Cd-substituted calcite crystals, thereby strengthening Cd sequestration and its long-term stability. In addition, under low-temperature stress, Pseudomonas sp. J-6 induced MICP reaction decreased the bioavailable Cd in alpine slag soil by 44.85 % and enhanced physical properties. In the freeze-thaw cycles, the remediation efficiency remained stable. This study clarified the biomineralization potential in high-altitude cryogenic environments and the nucleation process of Cd biomineralization by psychrophilic bacteria-induced carbonate precipitation, filling a critical research gap in its application under extreme conditions and highlighting its promise for sustainable remediation of heavy metal pollution under low-temperature stress.

Cadmium↗

PubMed2026

Integrative multi-omics analysis reveals lipid/metabolite dysregulation and temporal decoupling in disease progression.

Our study presents and applies a metabolomics-driven multi-omics integration strategy to elucidate dynamic pathway interactions during disease progression. We analyzed longitudinal metabolomics datasets from a Duchenne muscular dystrophy (DMD) mouse model (6-30 weeks) and an acute Bothrops asper envenomation model (1-24 h) to contrast chronic versus acute inflammation. In the DMD model, we predicted phased cross-talk between sphingolipid metabolism and neurotrophin signaling: an early proteomic surge followed by lipid-mediated amplification and a late convergence at the protein level. Arginine and proline metabolism exhibited early metabolite accumulation preceding delayed inferred protein changes, consistent with impaired nitric oxide synthesis and argininemia-like effect. We also predicted late-stage activation of the AGE-RAGE pathway in DMD, likely triggered by ceramide buildup, and an autophagy-related lipid metabolic shift at mid-stage. In the envenomation model, tryptophan-kynurenine and nicotinamide pathways for NAD⁺ biosynthesis were rapidly perturbed at the metabolite level (1-3 h) but induced corresponding predicted enzymes only by 24 h. Thyroid hormone signaling showed an early coupling of substrate availability (tyrosine surge at 1 h) with predicted stress-response proteins and a second, delayed wave of inferred transcriptional regulators at 24 h. Acute envenomation also triggered immediate glycine/serine utilization possibly for antioxidant defense and glycerophospholipid breakdown (via phospholipase A₂), whereas chronic DMD showed sustained glycine/serine engagement and inferred, unresolved phospholipid perturbation without protein-level compensation, which may result from chronic oxidative stress. Overall, our integrative analysis revealed time-specific, multi-layer molecular perturbations distinguishing acute toxin injury from chronic muscle degeneration. Key metabolic control points (ceramide accumulation, arginine flux diversion, autophagy-lipid cross-talk, NAD⁺ salvage timing) were identified, highlighting potential targets for stage-specific therapeutic or nutritional interventions.

Animals↗

PubMed2025

Proposal of real-world solutions for the implementation of predictive biomarker testing in patients with operable non-small cell lung cancer.

The implementation of biomarker testing for targeted therapies and immune checkpoint inhibitors is a cornerstone in the management of metastatic and locally advanced non-small cell lung cancer (NSCLC), playing a pivotal role in guiding treatment decisions and patient care. The emergence of precision medicine in the realm of operable NSCLC has been marked by the recent approvals of osimertinib, atezolizumab, nivolumab, pembrolizumab and alectinib for early-stage disease, signifying a shift towards more tailored therapeutic strategies. Concurrently, the landscape of this disease is rapidly evolving, with several further pending approvals and numerous clinical trials in progress. To harness the benefits of these innovative neo-adjuvant and adjuvant therapies, the integration of predictive biomarker testing into standard clinical protocols is imperative for patients with operable NSCLC. A multidisciplinary international consortium has identified three primary obstacles impeding the effective testing of patients with operable NSCLC. These challenges encompass the limited number of test requests by physicians, the inadequacy of tissue samples for comprehensive testing, and the prevalence of cost-reduction measures leading to suboptimal testing practices. This review delineates the aforementioned challenges and proposed solutions, and strategic recommendations aimed at enhancing the testing process. By addressing these issues, we strive to optimize patient outcomes in operable NSCLC, ensuring that individuals receive the most appropriate and effective care based on their unique disease profile.

Humans↗

PubMed2026

NoisyFlow: differentially private optimal transport using neural networks for secure biomedical data sharing across multiple institutions.

MOTIVATION: Biomedical models improve when trained on data pooled across institutions, but sensitive patient records (e.g. genomics, clinical data, and medical images) are difficult to share due to privacy constraints. Moreover, data collected at different sites often have shifted distributions because of covariate differences (including batch effects), so privacy-preserving sharing alone cannot simply resolve cross-site mismatch. Methods that protect individuals while explicitly aligning distributions are needed to enable reliable multi-institutional analyses. RESULTS: We present NoisyFlow, a three-stage differentially private framework for cross-institutional harmonization under distribution shift. In stage I, each site learns a differentially private flow-based generator of its local labeled distribution. In stage II, it learns a neural optimal transport map to a shared reference distribution. In stage III, a central server composes the released models to generate reference-aligned pseudo-data for downstream analysis without accessing raw records. Across four biomedical settings spanning single-cell genomics, histopathology, neurogenomics, and wearable sensing, NoisyFlow reduces distribution shift while preserving downstream utility under formal differential privacy guarantees. AVAILABILITY AND IMPLEMENTATION: The implementation of NoisyFlow is available at https://github.com/gersteinlab/NoisyFlow.

Information Dissemination↗

PubMed2026

Integrative multi-omics analysis of metabolite-protein interaction networks across different stages of coronary heart disease.

To elucidate the molecular characteristics of synergistic interactions across the clinical stages of coronary heart disease (CHD)-specifically stable angina pectoris (SAP), unstable angina pectoris (UAP), and acute myocardial infarction (AMI)-through integrated metabolomic and proteomic analyses. Based on a cohort including SAP, UAP, AMI, and healthy controls, metabolomic and proteomic analyses were performed to identify differentially expressed molecules, followed by KEGG pathway enrichment analysis. Pathways co-enriched across both omics platforms were selected to construct metabolite-protein interaction networks. The number of pathways co-enriched in both metabolomic and proteomic analyses increased markedly with disease stage. Only two pathways (histidine metabolism and arginine and proline metabolism) were identified in the SAP stage; this number increased to five in the UAP stage (including ferroptosis and efferocytosis) and expanded to 25 in the AMI stage, encompassing three major functional modules: immune inflammation, metabolic reprogramming, and cell signaling. The core network exhibited a stepwise increase in connectivity, shifting from a sparse structure in the SAP stage to a highly interconnected architecture in the AMI stage, with L-glutamate and KNG1 identified as the central hubs in this cross-sectional network. In addition, CNDP1 exhibited a stage-dependent functional transition, shifting from downregulation in SAP to upregulation in AMI. In this cross-sectional analysis, metabolic dysregulation and immune activation exhibited stepwise increases in interconnectivity across the SAP, UAP, and AMI groups, with the most extensive crosstalk observed in the AMI stage-a network configuration consistent with a tightly coupled "molecular storm". These findings provide novel insights into stage-associated molecular signatures of CHD and identify candidate hub molecules for stage-oriented therapeutic investigation.

Humans↗

PubMed2026

Adjuvant CDK4/6 inhibitors in early-stage breast cancer: Clinical evidence and considerations for risk stratification and treatment selection.

Hormone receptor-positive, human epidermal growth factor receptor 2-negative breast cancer is the most common biologic subtype and carries a persistent risk of recurrence, particularly in patients with high-risk, early-stage disease. Cyclin-dependent kinase 4 and 6 inhibitors, initially established as a standard component of first-line therapy in the metastatic setting based on improvements in progression-free and overall survival, have since been evaluated in the adjuvant setting. While adjuvant palbociclib did not improve invasive disease-free survival, the monarchE and NATALEE trials demonstrated that abemaciclib and ribociclib, respectively, reduce recurrence risk in patients with high-risk, early-stage disease, with emerging overall survival data further supporting their use. However, the absolute magnitude of benefit varies substantially with baseline risk, and treatment-related toxicity and adherence challenges must be considered, as approximately 20% to 25% of patients discontinue therapy before completion. The integration of these agents into clinical practice also intersects with ongoing efforts to deescalate axillary surgery, as treatment eligibility has been largely defined by anatomic staging, particularly nodal status. Available data suggest that the incremental impact of axillary surgery on identifying candidates for cyclin-dependent kinase 4 and 6 inhibition is modest, especially among the favorable-risk populations now eligible for surgical deescalation. As the field evolves, advances in molecular risk stratification, genomic profiling, and dynamic biomarkers are poised to shift treatment selection from anatomic staging toward biologically driven approaches. Multidisciplinary decision-making that integrates tumor biology, anticipated absolute benefit, toxicity, patient preferences, and surgical considerations will be essential to ensure individualized care.

Humans↗

PubMed2026

Circulating Tumor DNA in Bladder Cancer: Current Clinical Evidence and Emerging Multi-Omics Perspectives-A Narrative Review.

Background: Circulating tumor DNA (ctDNA) analysis has emerged as a promising tool for real-time disease monitoring in muscle-invasive bladder cancer (MIBC). This narrative review summarizes current clinical evidence regarding ctDNA across disease stages. Methods: We examine recent translational and clinical findings, incorporating key prospective data from practice-changing trials, as well as insights into minimal residual disease (MRD) detection, treatment escalation and de-escalation strategies, and systemic barriers to adoption. Results: Postoperative ctDNA positivity consistently identifies patients with molecular residual disease (MRD) who face a substantially higher risk of recurrence and mortality, frequently preceding radiographic relapse by several months. Prospective evidence now validates ctDNA as a predictive biomarker to guide adjuvant immunotherapy escalation, while sustained ctDNA negativity correlates with high long-term disease-free survival. Beyond plasma ctDNA, emerging multi-compartment liquid biopsies-integrating urinary tumor DNA (utDNA)-demonstrate enhanced sensitivity, particularly in bladder-sparing and local surveillance settings. Furthermore, integrating genomic ctDNA profiling with novel post-transcriptional layers like epitranscriptomics offers a functional framework to capture tumor adaptation under therapeutic pressure. However, clinical translation remains constrained by a lack of assay harmonization, variable analytical sensitivity, and the need for standardized intervention thresholds. Conclusions: Longitudinal liquid biopsies are rapidly shifting MIBC management from static, stage-based paradigms toward dynamic, molecularly informed precision oncology. While ctDNA-guided strategies show robust clinical utility, prospective interventional validation and technical standardization are required before widespread routine integration.

biomarkers↗

PubMed2026

Reframing early gastric carcinogenesis through lineage, niche, and evolution.

Early gastric cancer is still commonly conceptualized as the endpoint of a linear sequence from chronic gastritis to intestinal metaplasia, dysplasia, and invasion. Yet recent single-cell, spatial, genomic, and functional studies indicate that this model incompletely captures the biology of early gastric carcinogenesis. Malignant potential is established progressively within a precancerous gastric field already shaped by somatic evolution, chronic inflammatory injury, and epithelial lineage distortion. Within this field, progression is concentrated in a restricted set of precursor states, particularly incomplete, hybrid, and stem-like metaplastic populations that display plasticity, persistence, and increasing compatibility with a supportive microenvironment. Fibroblast niche remodeling, immune protection loss, endothelial rewiring, genomic instability, epigenetic drift, and selective retention of advantageous molecular alterations further promote malignant commitment. In parallel, diffuse gastric cancer appears to follow a distinct route that may arise independently of conventional intestinal metaplasia through E-cadherin-deficient epithelial transformation and downstream chromatin reprogramming. Here, we synthesize recent evidence to propose an updated framework for early gastric carcinogenesis based on field evolution, lineage instability, ecosystem support, and pathway divergence. Rather than replacing the classical Correa cascade, this framework seeks to refine it by shifting the unit of risk assessment from histologic stage alone to biologically defined precursor states shaped by lineage instability, clonal persistence, niche permissiveness, and pathway-specific molecular constraints. This perspective shifts the emphasis of prevention from detecting smaller cancers to identifying and intercepting biologically committed precursor states before invasion occurs.

Humans↗

PubMed2026

Hydrogen-supported biodefluorination of unsaturated perfluorinated carboxylic acids.

PFMeUPA (i.e., (E)-perfluoro(4-methylpent-2-enoic acid) is a unsaturated perfluorohexanoic acid wtih emerging concern due to its potential to cause developmental toxicity. Here, we investigate the sustainable biological treatment of PFMeUPA under anoxic conditions by delineating batch degradation potential and continuous-flow reactor dynamics using hydrogen (H2) as the sole electron donor. In batch assays inoculated with anaerobic digestion sludge, an enriched hydrogenotrophic consortium achieved near-complete removal of 50 μM PFMeUPA over 90-days with a stoichiometric release of 125 μM fluoride (F-), representing a 26% defluorination extent that corresponds to the cleavage of two C-F bonds per molecule. The continuous-flow H₂-based membrane biofilm reactor (MBfR) harboring this enriched anaerobic biofilm was operated for 130 days, achieving 100% removal of 5 μM PFMeUPA and 20% of defluorination at a hydraulic retention time (HRT) = 6 h. Transformation product identification using high-resolution mass spectrometry suggests dominance of reductive defluorination and a shift toward hydrogenated byproducts at later stages. Metagenomic results indicate the enrichment of microbial taxa including Hydrogenophaga (hp_bin.22) and and Azonexus (hp_bin.19) genomes, which carry genes for hydrogen metabolism (hoxH) and fluoride efflux pumps (crcB). This work demonstrates the feasibility of hydrogen-supported biological treatment for unsaturated perfluorinated carboxylic acids from contaminated water. SYNOPSIS: We demonstrate reductive defluorination of branched PFAS by a H2-fed biofilm, with co-occurring hydrogenase and fluoride exporter genes in Hydrogenophaga and Azonexus as potential biodefluorination biomarkers.

Hydrogenotrophic biodefluorination↗