PubMed HealthSearch

SEARCH · PubMed Health

Results for “Thyroid hormones”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

Seasonal effects of tropical climate on shaded and nonshaded cows as measured by rectal temperature, adrenal cortex hormones, thyroid hormone, and milk production.

Rectal temperatures and hormone concentrations were monitored at intervals of 2 to 3 weeks, and milk, milk fat, and California mastitis test scores at intervals of 1 week in five shaded and in four nonshaded early lactation cows. Measurements were taken from September to December in the mildly heat stressing climate of Oahu, Hawaii. The daily ambient temperature flux ranged from 22 C to 29 C in September to 20 C to 25 C in December. Average daily temperature-humidity index (THI) values were 75 to 70 for September and December, respectively. Average daily THI values were correlated with rectal temperatures in nonshaded cows and were negatively correlated with plasma adrenal cortex hormones (corticoids) in shaded cows, plasma thyroid hormone in shaded and nonshaded cows, and with milk production in nonshaded cows. Estimated milk production decline per unit increase in THI was 0.32 kg. Nonshaded cows had higher rectal temperatures, a trend for lower plasma corticoids, produced less milk and milk fat, and had higher California mastitis test scores. Shaded cows maintained a higher fat percentage at THI above 74. Average plasma thyroid hormone values were not different between treatment groups. Both groups failed to attain normal rectal temperatures at night. Afternoon rectal temperatures were more highly correlated with the rectal temperature with which the cow started the day than they were with the THI of the day itself.

Adrenal Cortex Hormones

The action of thyroid hormone.

Thyroid hormone affects both developmental and metabolic processes. It has a relatively specific effect on the synthesis of a number of enzymes and other proteins. The fundamental cellular mechanism of action seems to be at the level of genetic regulation. It involves interaction with nuclear receptors, leading to an activation of the protein synthesizing machinery. How binding to receptors is coupled to genetic activation is completely unknown. At least part of the metabolic effects of thyroid hormone could be mediated through an interaction with mitochondria and cell membrane, and with some enzymatic systems such as adenylcyclase.

Animals

Corticosteroids and thyroid function. Different effects on plasma volume, thyroid hormones and thyroid hormone-binding proteins after oral and intravenous administration.

The influence of glucocorticosteroids on plasma volume, thyroid hormones and thyroid hormone-binding proteins was studied in 17 patients. Plasma volume was not affected either by i.v. beta-methasone (6 mg daily) or by oral prednisolone (45--180 mg daily) given for 5 days. The serum T3 concentration decreased while rT3 increased independently of the route of administration of corticosteroids. Serum T4 concentration decreased after i.v. but not after oral administration of corticosteroids. Oral steroids as compared to i.v. increased the 125I-triiodothyronine uptake test value. The serum TBG concentration decreased independently of the route of administration, while the serum TBPA concentration increased after oral corticosteroids but was unchanged after i.v. treatment. The serum TSH concentration was slightly reduced. About half of the patients were given both corticosteroids and nutrition i.v. and the other half were given all treatment by mouth. The part played by the route of administration of corticosteroids and calories, respectively, cannot be evaluated at present but these factors seem to be of importance.

Administration, Oral

Abnormal gamma globulin binding of thyroid hormones.

Thyroid hormone levels were studied in a thyrotoxic patient, who was treated with propylthiouracil. He had heavily increased triiodothyronine concentrations, measured by radioimmunoassay, in spite of only mild clinical symptoms of thyrotoxicosis. A moderately increased serum triiodothyronine concentration was observed in another patient, who was euthyroid and who had recently recovered from subacute thyroiditis. By gel electrophoresis and precipitation tests with human anti-IgG and anti-IgA, a binding to the gamma globulins of both triiodothyronine and thyroxine was detected in patient 1, and of triiodothyronine in patient 2. Such abnormal binding may result in serious errors in the determination of thyroid hormone concentration by radioimmunoassay.

Adult

Effect of adrenal hormones on thyroid secretion and thyroid hormones on adrenal secretion in the sheep.

1. Previous work has shown that after stressful stimuli, sheep initially secrete increased amounts of thyroid hormone, at a time when adrenal secretion is also elevated. 2. This study was designed to evaluate (a) any short-term activation or inhibition of thyroid secretion by exogenous cortisol or ACTH administered in quantities comparable to those secreted after stress in sheep and (b) any short-term effect that exogenous thyroxine or triiodothyronine may have on the concentration of plasma cortisol in the sheep. 3. Thyroid activity was measured by determination of plasma protein bound 125I (PB125I) and total 125I in thyroid vein and mixed venous (jugular) blood. Plasma cortisol and thyroxine concentrations were measured by a competitive protein-binding assay at intervals for up to 5 hr after commencement of the experiment. 4. No evidence of an activation of thyroid secretion was found during cortisol or ACTH infusion, as monitored by thyroid vein PB125I. Similarly there was no evidence of any inhibition of thyroid function, as measured by continued secretion of thyroid hormones into thyroid vein blood. 5. No effect on plasma cortisol concentration due to thyroid hormone treatment was observed. 6. It was concluded that (a) elevated circulating corticosteroids in physiological concentrations have no short-term effects on thyroid activity in the sheep and (b) the short-term alterations in thyroid and adrenal cortical secretion observed during stress in the sheep could not be attributed to direct interaction of elevated thyroid hormone concentrations with adrenal cortical secretion.

Adrenal Glands

Serum concentrations of thyrotropin, thyroid hormones and thyroid hormone-binding proteins during acute and recovery stages of idiopathic respiratory distress syndrome.

A total number of 27 premature infants with idiopathic respiratory distress syndrome (IRDS) and 52 healthy controls with comparable gestational age and body weights were studied during the first month of life. In infants with IRDS a reduced thyrotropin (TSH) response to birth was suggested, as serum TSH was lower in IRDS patients than in controls during the first two days of life. Low serum concentrations of thyroid hormones were found in the acute stage of IRDS reaching minimal values by day 3--5. After that period an increase in thyroid hormone levels occurred. The serum T2 increased to the level of healthy prematures by day 6--10, whereas the serum T4 increased to normal levels by day 21--30. Serum concentrations of thyroxine-binding globulin (TBG) were significantly lower in IRDS patients than in healthy controls; a gradual increase to normal levels occurred during recovery. Serum prealbumin (TBPA) levels in IRDS infants increased rapidly after birth and exceeded levels of healthy infants. Serum albumin values were not significantly different in the two groups of infants. The serum T4/TBG ratios were low during recovery from IRDS.

Humans

Changes in serum concentrations of thyroid hormones and thyroid hormone-binding proteins during early infancy. Studies in healthy fullterm, small-for-gestational age and preterm infants aged 7 to 240 days.

Serum concentrations of thyrotropin (TSH), thyroxine (T4), triiodothyronine (T3), thyroxine-binding globulin (TBG), prealbumin (TBPA) and albumin (Alb) were determined in 492 blood samples from 127 fullterm (FT), 91 small-for-gestational age (SGA) and 88 preterm (PT) healthy infants aged 7 to 240 days. Serum T4 decreased about 20% during the first month of life. In infants aged 7--49 days, serum T4 concentrations were significantly lower in SGA than in FT infants, and even lower values were found in PT infants. Serum T3 increased 50--70% reaching maximal values by 50--79 days of life. Serum T3 levels were higher in FT than in SGA infants throughout the observation period. In PT infants serum T3 increased from low values to levels which exceeded those of SGA and FT infants by 120--240 days of life. Serum TSH level did not change with age and was less than or equal to 5 mU/l in all infants. Serum TBG values were high compared to normal adult values and did not change significantly with age. Comparable serum TBG values were found in FT, SGA and PT infants. Serum TBPA increased with age. Serum TBPA increased gradually in FT infants. In SGA infants serum TBPA increased from low values to levels which by 120--240 days of life exceeded those of PT and FT infants. In PT infants a decrease in serum TBPA appeared before the rise commenced. Serum Alb increased gradually in FT, SGA and PT infants during the observation period. Serum Alb in PT infants aged 30--119 days was lower than those in FT infants with similar ages. These physiological changes in serum concentrations of thyroid hormones and hormone-binding proteins during early infancy should be considered when interpreting thyroid function tests in infants with various maturity.

Age Factors

A comparison of the effects of the calcitonins, steroid hormones and thyroid hormones on the response of bone to parathyroid hormone in tissue culture.

A bone culture system was used to compare the effects of several hormones on the response of 5-day-old mouse calvaria to parathyroid hormone (PTH). The results showed that salmon calcitonin was almost 10-5 times more active than any other hormone in preventing the PTH-induced release of calcium and caused a dose-related inhibition of calcium release over a range of 0-2-200 milli MRC units/culture. A high dose of calcitonin (200 milli MRC units) caused a net accretion of calcium in the absence of PTH. Progesterone and testosterone were more active than the naturally occurring oestrogens although a synthetic oestrogen (stillboestrol diphosphate) had approximately the same potency. High concentrations of these hormones caused a net accretion of calcium whether or not PTH was present. Cortisol was only effective at high doses, as was the steroid precursor cholesterol. In the present culture system the thyroid hormones (triiodothyronine and thyroxine) inhibited the action of PTH. It was concluded that these agents acted in a similar fashion to the oestrogens. That is, they prevented the accumulation of citric acid induced by PTH by reducing the rate of glycolysis. None of the hormones affected the inhibition of citrate oxidation caused by PTH. The results also showed that, whilst these hormones inhibited PTH-mediated bone resorption, they had an action on bone independent of PTH. Experiments with clomiphene citrate failed to demonstrate an oestrogen receptor in bone.

Animals

Thyrotropin-releasing hormone and thyroid hormone interactions on thyrotropin secretion in the rat: lack of inhibiting effects of small doses of triiodo-L-thyronine in the hypothyroid rat.

Rats were thyroidectomized (T) and injected once daily with thyroxine (T4) or triiodothyronine (T3) ip; circulating thyrotropin (TSH) levels and TSH response to 100 ng of thyrotropin releasing hormone (TRH) iv, were measured in different groups of rats at several intervals after the last dose of T4 or T3. It was found that T rats on 1.8 mug T4 or 0.4 mug T3/100 g BW/day, response to TRH decreased after the injection of the hormone, maximum suppressive effect being found about 7-8 h after T4, or 4 h after T3. The response increased as T4 or T3 levels reached a nadir, in agreement with present views on TRH, T4, and T3 interactions at the pituitary level. The degree of TSH response to TRH appears as a sensitive parameter of T4 or T3 activity in this experimental model. However, in T rats on 0.2 mug T3/100 g BW/day, TSH response to TRH did not decrease, but actually increased, after the daily injection of T3. These animals appeared to be in a state of continuous thyroid hormone deficiency. The same 0.2 mug T3 dose effectively suppresses the elevated basal TSH levels of these animals. It is also capable of decreasing TSH response to 100 ng TRH in animals under more "euthyroid" conditions. These results in the T rats on 0.2 mug T3 are not easily fitted into the relatively simple model frequently described to explain TRH-T3 interactions and TSH secretion.

Animals

Differential regulation of insulin-like growth factor I by growth hormone and thyroid hormone in the heart of juvenile hypophysectomized rats.

Recent data suggest that the heart can act as both a source and target for the actions of polypeptide growth factors. Insulin-like growth factor I (IGF-I) is a polypeptide that has both mitogenic and differentiation properties that function at the autocrine/paracrine level, and has recently been demonstrated to be expressed in the heart. This knowledge, coupled with the observation that thyroid hormone (T3) promotes relative cardiac growth compared to the proportional increases in body and heart growth evoked by growth hormone (GH), lead us to speculate whether differential induction of cardiac IGF-I may account for the specialized trophic effects of T3 on the heart. Cardiac IGF-I gene expression was studied in an in vivo model in which cardiac growth in the hypophysectomized juvenile rat was stimulated with either GH, T3 or GH + T3. Two week infusions of T3 that resulted in cardiac growth, but no gain in body weight, resulted in a 4.6-fold increase in cardiac IGF-I mRNA levels compared to hypophysectomized controls. GH infusions that resulted in similar cardiac growth, but were accompanied by proportional body growth, had no effect on cardiac IGF-I mRNA levels. These data are the first to demonstrate stimulation of cardiac IGF-I mRNA levels by T3 and further support cardiac autocrine/paracrine actions for this polypeptide growth factor.

Animals

The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element.

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.

Actins

Thyroid metabolism in the recessive sex-linked dwarf female chicken. 1. Age related changes in thyroid hormone synthesis and circulating thyroid hormone levels.

Age related changes in the levels of circulating thyroid hormones as well as the type of hormones synthesized in the thyroid glands from normal and sex-linked recessive dwarf, female chickens were studied. The impact of the presence of the dwarf gene on the parameters measured was minimal but significant alterations in the types of hormones produced in the thyroid gland with increasing age were observed. As the birds approached sexual maturity, the synthesis of triiodothyronine increased sharply such that the ratio of triiodothyronine (T3): tetraiodothyronine (T4) was approximately 15:1. This was in contrast to the T3:T4 ratio of younger birds which was approximately 0.7:1.0. This shift in hormone synthesis was reflected in relatively more circulating T3 in laying hens when compared with younger birds. It was also noted that four week old dwarf birds had higher circulating T3 values than those found for the normals.

Age Factors

The thyroid hormone receptors: molecular basis of thyroid hormone resistance.

Major progress has been achieved in the mechanism of action of thyroid hormones thanks to the identification of the T3 receptor as the product of the proto-oncogene c-erbA. Recognition of subsets of receptors with and without T3-binding properties and of the interaction of different receptors with each other leads to new insights in cell regulation and development. In thyroid hormone resistance, distinct mutations in the T3-binding domain of thyroid hormone receptor (TR)beta have been identified in unrelated families. No correlation between the type of mutation and tissue resistance has been established. Mutant TRs bind to thyroid hormone response elements (TREs) on both negative or positive T3-controlled genes. Subjects with heterozygous TR beta gene deletion are not affected, supporting the hypothesis that mutant TRs act through a dominant negative effect. In generalized thyroid hormone resistance, mutated TR beta may interfere through competition for TREs and/or formation of inactive dimers. Finally, deficiency in T3 receptor auxiliary protein or other accessory proteins or competition between mutant and normal TRs for these factors is not excluded.

Binding Sites

Thyrotropin-releasing hormone and thyroid hormones in amniotic fluid.

Immunoassayable TRH (iTRH) was measured in 50 amniotic fluid specimens with a mean concentration of 207 +/- 26 (SE) pg/ml. This iTRH demonstrates parallelism with the standard curve for synthetic TRH. With increasing gestational age there is an increase in iTRH levels in amniotic fluid with a decrease in 3,3',5'-triiodothyronine levels (rT3), while thyroxine levels (T4) remain unaltered. Preliminary data suggest that iTRH levels in amniotic fluid that are less than 150 pg/ml after 32 weeks of gestation may correlate well with low Apgar scores at birth. There was no correlation of rT3 or T4 amniotic fluid levels with the Apgar scores.

Amniotic Fluid

Role of selected endogenous peptides in growth hormone-releasing hexapeptide activity: analysis of growth hormone-releasing hormone, thyroid hormone-releasing hormone, and gonadotropin-releasing hormone.

The purpose of this study was to evaluate the contribution of endogenous GH-releasing hormone (GHRH) to exogenous GH-releasing hexapeptide (GHRP-6) activity, and to determine whether TRH or GnRH are endogenous analogs of GHRP-6. The activity of GHRP-6, a synthetic GH secretagogue, was significantly attenuated in rats administered GHRH antiserum or alpha-methyl-rho-tyrosine to reduce endogenous GHRH concentrations, and also in rats administered 5-50 micrograms/kg of [N-Ac-Tyr1,D-Arg2]-GRF 1-29 amide to block pituitary GHRH receptors. However, GHRP-6 activity was potentiated in rats administered 150 micrograms/kg [N-Ac-Tyr1,D-Arg2]-GRF 1-29 amide, presumably due to partial agonist activity of the GHRH receptor antagonist at the higher dose. These data show that endogenous GHRH contributes to full expression of exogenous GHRP-6 activity in vivo. Like TRH, a subthreshold dose of GHRP-6 was significantly more effective in hypothyroid rats than in euthyroid rats. However, suprathreshold doses of GHRP-6 were less effective in hypothyroid rats. Unlike TRH, GHRP-6 had no effect on GH and prolactin release from GH3 cells, and TRH and GnRH were poor competitors for 3H-GHRP-6 binding sites on pituitary membranes. A GnRH receptor antagonist did not block GHRP-6 activity in vivo, and GnRH administered alone or in combination with GHRP-6, did not stimulate GH release. The results of this study suggest that synergy between GHRH and GHRP-6 seen in pharmacological studies is physiologically relevant, and that TRH and GnRH are not endogenous analogs of GHRP-6.

Animals

New insights on the mechanism(s) of the dominant negative effect of mutant thyroid hormone receptor in generalized resistance to thyroid hormone.

Generalized resistance to thyroid hormone (GRTH) is a syndrome of hyposensitivity to triiodothyronine (T3) that displays autosomal dominant inheritance. The genetic defect commonly lies in the ligand-binding domain of one of the TR beta alleles. Since there are two major thyroid hormone receptor (TR) isoforms, TR alpha and TR beta, it is not known how the mutant receptor mediates a dominant negative effect. Previously, we showed that T3 caused dissociation of TR homodimers and TR alpha/TR beta dimers from several thyroid hormone response elements (TREs). Hence, we used the electrophoretic mobility shift assay to compare the effect of T3 on the DNA binding of mutant TR beta-1 (Mf-1) from a kindred with GRTH with normal TR beta. Mf-1 bound better as a homodimer than TR beta, but dissociated from DNA only at high T3 concentrations. Both receptors heterodimerized with nuclear auxiliary proteins. They also dimerized with TR alpha and with each other. Surprisingly, T3 disrupted the DNA binding of the Mf-1/TR isoform dimers. Thus, mechanisms for the dominant negative effect by mutant TRs likely involve either increased binding to TREs by mutant homodimers that cannot bind T3 (hence cannot dissociate from DNA) and/or the formation of inactive mutant TR/nuclear protein heterodimers.

Animals

Pituitary resistance to thyroid hormones.

Pituitary thyroid hormone resistance (PRTH) refers to a particular form of thyroid hormone refractoriness that is accompanied by peripheral hyperthyroidism, as only the TSH-secreting pituitary cells appear to be resistant to the effects of thyroid hormones. The presence of PRTH is suspected and diagnosed on the basis of the finding of high free thyroid hormone levels along with unsuppressed TSH, clinical signs and symptoms of hyperthyroidism and values of at least one of the parameters evaluating peripheral thyroid hormone action in the hyperthyroid range. However, most patients with PRTH present with clinical signs and symptoms of thyroid dysfunction, particularly goiter and tachycardia, overlapping those recorded in patients with generalized thyroid hormone resistance (GRTH), i.e. refractoriness to thyroid hormones at both pituitary and peripheral tissue level. Moreover, most of them display normal values of other parameters evaluating the peripheral effects of thyroid hormones and bear mutations in the gene encoding for T3 nuclear receptors similar to those found in patients with GRTH. These findings are questioning the existence of PRTH as a separate clinical entity and support the view that the various forms of thyroid hormone resistance may be part of a spectrum of disease with variable expression in different issues.

Adolescent