PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “V(D)J recombination”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources
PubMed2026

An Update on Inborn Errors of V(D)J Recombination.

V(D)J recombination is the fundamental process by which developing T and B lymphocytes generate diverse antigen receptors, enabling adaptive immunity. This tightly regulated program operates exclusively in lymphoid precursors during G1 phase and depends on the lymphocyte-specific RAG1-RAG2 recombinase to introduce programmed DNA double-strand breaks at recombination signal sequences, followed by repair through the classical nonhomologous end joining (c-NHEJ) pathway. Disruption of any step in this molecular choreography compromises antigen receptor diversity and underlies a spectrum of inborn errors of immunity (IEIs), ranging from severe combined immunodeficiency (SCID) to immune dysregulation with autoimmunity and granulomatous disease. In this review, we place disorders of V(D)J recombination within the broader framework of T-cell development, detailing the temporal waves of recombinase activity, chromatin accessibility, and DNA damage responses that guide thymocyte differentiation. We discuss pathogenic variants affecting the cleavage phase [RAG1, RAG2, and the recently identified RAG cochaperone NudC domain-containing 3 (NUDCD3)], end processing (ARTEMIS), ligation and repair (LIG4, XLF, XRCC4, PRKDC), and genome surveillance pathways (ATM, MRN complex, RNF168), highlighting genotype-phenotype correlations and mechanisms driving immune deficiency and dysregulation. We briefly review recent diagnostic advances, including newborn screening using T-cell receptor excision circles, repertoire sequencing, and functional assays, alongside current therapeutic strategies. Finally, we outline key unanswered questions and argue that continued integration of clinical observation with molecular discovery is essential to improve outcomes and deepen understanding of adaptive immune development.

Humans↗
PubMed2026

Antibody diversification in cartilaginous fishes: Mechanistic insights from the nurse shark and comparative perspectives across jawed vertebrates.

Antibody diversity in vertebrates arises through the coordinated actions of V(D)J recombination and somatic hypermutation (SHM). Cartilaginous fishes occupy a key phylogenetic position as the sister lineage to bony vertebrates and therefore provide important comparative insights into the evolution of adaptive immunity. This review focuses on the nurse shark (Ginglymostoma cirratum) as a representative model for examining antibody-diversification mechanisms in cartilaginous fishes. Shark immunoglobulin genes exhibit a multicluster organization, while immunoglobulin new antigen receptor (IgNAR), a heavy-chain-only isotype, contains a single variable domain with an extended complementarity-determining region 3 (CDR3) that can be stabilized by non-canonical disulfide bonds. These structural features, together with intracluster multi-D V(D)J recombination and distinctive SHM characterized by single and tandem substitutions and insertions/deletions, contribute to antibody diversification in sharks. By comparing cartilaginous fishes, ray-finned fishes, and mammals, this review highlights lineage-specific combinations of immunoglobulin gene organization, recombination, mutational processing, and affinity maturation. Within the heuristic framework proposed here, shark and mammalian systems are described as emphasizing "breadth-first" repertoire generation and "precision-first" affinity optimization, respectively. These terms indicate relative mechanistic emphases rather than mutually exclusive categories or sequential evolutionary stages, while ray-finned fishes exhibit a distinct combination of genomic organization and mutational features. Investigating antibody diversification in cartilaginous fishes not only advances our understanding of vertebrate immune evolution but also provides structural and mechanistic insights that may inform the development of engineered antibodies based on the IgNAR scaffold.

Antibody diversity↗
PubMed2026

Characterization of a Ku-binding motif in the C-terminal region of RAG2.

We applied an unsupervised interactome analysis with the RAG2 C-terminal region (R2CT) in v-abl pro-B cells undergoing V(D)J recombination. Mass-spectrometry analyses showed that Ku70 and Ku80 were among the top 10 hits. To further strengthen these observations, we performed Proximity Ligation Assay (PLA) and characterize the existence of a GFP-R2CT-Ku complex formation in cellulo. The interaction of several partners with Ku70/80 (Ku) through Ku-binding motifs (KBMs) in their sequences governs their enrolment in NHEJ repair complexes. Through sequence analysis, we identified a KBM within R2CT (R-KBM, amino acids 589-527). We confirmed by calorimetry a specific micromolar interaction between this RAG2 region and Ku70/80/DNA complex. The RAG2 motif KBM can be subdivided in two conserved parts that have no interaction individually. AlphaFold2 prediction coupled with molecular dynamic simulations indicate that the C-terminal part of the RAG2 motif interacts with Ku80 on the same site than the NHEJ factor XLF. These in silico analyses indicated that the N-terminal part of the RAG2 motif interacts with DNA adjacent to Ku with a major role of the K503 residue in agreement with disruption of the interaction observed with the K503E mutant. This study further extends the large ensemble of proteins recruited at DSBs by KBM motifs and substantiates the model of a tight coupling between DNA breakage and repair during V(D)J recombination, mediated by the Ku-RAG2 C-terminus interaction.

Ku Autoantigen↗
PubMed2025

Comparative Analysis of Mammalian Adaptive Immune Loci Revealed Spectacular Divergence and Common Genetic Patterns.

Adaptive immune responses are mediated by the production of adaptive immune receptors, antibodies, and T-cell receptors, which bind antigens, thus causing their neutralization. Unlike other proteins, adaptive immune receptors are not fully encoded in the germline genome and result from a complex of somatic processes collectively called V(D)J recombination affecting germline immunoglobulin (IG) and T-cell receptor (TR) loci consisting of template genes. While various existing studies report extreme diversity of antibodies and T-cell receptors, little is known about the diversity of germline IG and TR loci. To overcome this gap, the first comparative analysis of full-length sequences of IG/TR loci across 46 mammalian species from 13 taxonomic orders was performed. First, germline gene counts were shown to correlate in immunoglobulin heavy chain immunoglobulin heavy chain (IGH)/immunoglobulin lambda (IGL) loci and T-cell receptor alpha (TRA)/T-cell receptor beta (TRB) and anticorrelate in immunoglobulin kappa (IGK)/IGL, possibly indicating coevolution between corresponding chains. Second, structures of IG/TR loci were analyzed, and it was shown that IG/TR loci formed by long arrays of high multiplicity repeats are more common for species that have experienced population bottlenecks. Finally, haplotypes of IG/TR loci with little or no sequence similarity within a species were found, suggesting that they may have a limited potential for homologous recombination. These results demonstrate that IG/TR loci are rapidly evolving genomic regions whose structural variation is shaped by the population history of the species and open new perspectives for immunogenomics studies.

Animals↗
PubMed2026

Enterococcus faecalis GP1764 induces an early differential gene expression in the intestine on key pathways related to cellular immune response and gut barrier function in chickens.

The aim of the present study was to elucidate the mode of action of Enterococcus faecalis GP1764 in improving performance traits during the starter phase by analyzing genome-wide gene expression and its interaction with microbial populations in the intestine of chickens challenged with an NSP-rich diet. At day 7, microbiota populations from ileal and cecal contents and transcriptomics from jejunal and cecal mucosa were analyzed between Control (Ctrl) and Enterococcus faecalis GP1764 (EntF) groups. Results from microbiota analysis demonstrated that EntF shifted β-diversity indices in ileum (neutral (p= 0.006) and phylogenetic (p= 0.006)) and caecum (phylogenetic (p= 0.017)). Transcriptomics revealed 43 differentially expressed genes for EntF vs. Ctrl in the jejunal mucosa. Of these, MHCY-36 (MHC-I-Related), RAG2 and MUC19-like genes were upregulated in EntF vs. Ctrl, protein-coding genes with immunomodulatory capacities as supported by GSEA and Cytoscape-ClueGo pathway analyses. Results suggest an intestinal immunomodulation induced through presentation of B vitamins metabolites, synthetized by EntF, to an undescribed subset of innate-like unconventional T lymphocytes in chickens, similar to MAIT cells in mammals. These cells could contribute to antibacterial responses and repair of damaged barrier tissue after inflammatory processes. The upregulation of the MUC19-like gene expression observed in the jejunal mucosa can protect gut integrity via the promotion of mucus production by goblet cells. Finally, RAG2, involved in V(D)J coding segments recombination in B- and T-cells may provide a greater recognition of foreign invaders, allowing the animals to efficiently fight against pathogenic infections. Collectively, these results suggest an important role of EntF in promoting the capacity of animals to rapidly act against pathogenic challenges, herein, inducing resilience towards dietary ingredients with anti-nutritional activity that impart moderate inflammation in chickens.

Enterococcus faecalis↗
PubMed1976

Genetic effects induced in Saccharomyces cerevisiae by cyclophosphamide in vitro without liver enzyme preparations.

Cyclophosphamide induced forward mutation in Saccharomyces cerevisiae strain S288C and mitotic recombination in strains D3 and D5 but not in strain D4. The yeast cells were treated with the compound in phosphate buffer without recourse to metabolic activation protocols. Elevation of the treatment temperature increased the genetic activity of cyclophosphamide. Respiration-deficient isolates of strains S288C and D3 were more sensitive than the respiratory competent parent strains were for inducing forward mutation and mitotic recombination, respectively. Cyclophosphamide was incubated in phosphate buffer alone for increasing time intervals; strain D3 cells were added to aliquots for each time interval and incubated for an additional 30 min. The frequency of induced recombination increased as the time of compound incubation increased, showing that spontaneous degradation of cyclophosphamide to genetically active breakdown products was responsible for the genetic damage induced in the yeast cells.

Cyclophosphamide↗
PubMed1976

Genetic studies in inbred rats. VI. Linkage relationships of mixed lymphocyte reactivity, serologically defined antigens (Ag-B, Ag-C) and the immune response to poly(Glu52Lys33Tyr15).

The Ag-B allotype, mixed lymphocyte reactivity (MLR) and the immune response to poly(Glu52Lys33Tyr15) were assayed in male rats from the F2 hybrid and two backcross generations of the F344 and DA strains in order to investigate the structure of the rat major histocompatibility complex. No disparity between Ag-B type and mixed lymphocyte reactivity was found in 263 animals. The immune response to poly(Glu52Lys33Tyr15) was closely linked to the Ag-B locus, and both antibody production and the delayed hypersensitivity response were under polygenic control. These results suggest that the genetic loci which determine these responses in the rat are closely linked and that recombinational events between the Ag-B and MLR loci are infrequent.

Animals↗
PubMed1978

Physical mapping of herpes simplex virus-coded functions and polypeptides by marker rescue and analysis of HSV-1/HSV-2 intertypic recombinants.

A number of temperature-sensitive (ts) mutants and one pyrimidine deoxyribonucleoside kinase-deficient mutant of herpes simplex virus (HSV), have been located on the physical map of the genome by means of marker rescue experiments and by the analysis of the crossover points in intertypic recombinants between HSV types 1 and 2. The physical map is compared to the genetic map and certain anomalies identified. Analysis of infected-cell polypeptides specified by intertypic recombinants has allowed tentative map co-ordinates to be assigned to the structural genes (or genes which cause post-translational modification) for many of the polypeptides. Immediate-early, phosphorylated, glycosylated and structural as well as non-structural polypeptides have been analysed in this way and it can be concluded that there is no restriction of any of these groups of polypeptides to either the long or the short regions of the genome. One of the recombinants, 2853, is at least partially "frozen" in one orientation of the long region. This orientation is also the one which exhibits a minimum number of crossovers in three other recombinants.

Chromosome Mapping↗
PubMed1977

The graft-versus-host reactivity in AG-B/MLR disparate strains of rats.

Inbred strains of rats can currently be classified into eight Ag-B groups. Within an Ag-B group, individual strains generally share identity both the Ag-B histocompatibility antigens and mixed lymphocyte responses. In this report we present data from three strains which are Ag-B and mixed lymphocyte reaction (MLR) disparate: KGH (Ag-B7, MLR-1), MNR (Ag-B4, MLR-5), and B3 (Ag-B3, MLR-4). Popliteal lymph node assays involving these three strains and standard inbred strains demonstrate that the graft-versus-host reaction and MLR reactions in the rat are closely related. Positive graft-versus-host reactions were observed only in strain combinations incompatible for the MLR and were unaffected by differences in their Ag-B histocompatibility antigens. The close association of the MLR and graft-versus-host reaction provides additional evidence that the Ag-B/MLR disparity in these strains is the result of natural genetic recombinations within the major histocompatibility complex.

Animals↗
PubMed1977

Cloning of chemically synthesized lactose operators.

Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.

Coliphages↗
PubMed1979

Structural evidence for independent joining region gene in immunoglobulin heavy chains from anti-galactan myeloma proteins and its potential role in generating diversity in complementarity-determining regions.

We have determined the variable region sequences of four heavy chains from beta(1-6)D-galactan-binding myeloma proteins. Two of these proteins are identical to position 100 which is located in the third complementarity-determining region (CDR-3). The remaining two differ at a total of 8 positions over the first 100 amino acids, and all of the differences can be explained by single-base mutations at the DNA level. When an assessment is made of the protein segment following CDR-3, which has been termed "J segment" or "FR4," a completely different pattern of variation is observed. The J segments from the four proteins can be divided into two sets. Members of each set share a series of linked amino acids not found in members of the alternative set. The two proteins identical to position 100 have J segments from the two different sets, suggesting that recombination has occurred between V and J genes. An examination of the CDR-3 sequences from the four heavy chains reveals substitutions at positions 100 and 105. Gly is found at 100 in two of the proteins and His in the remaining two. In the two proteins with Gly-100, the following J sequence is limited to one of the two sets of J segments defined by linked amino acids. Similarly, the two heavy chains with His-100 have J segments from the second set. Thus, at the protein level an apparent association is seen between CDR-3 and J segment. If CDR-3 should be found linked to J segment at the DNA level, a new mechanism would be introduced for increasing antibody diversity by recombining various CDR-3 plus J genes with genes coding for the remainder of the variable region. Alternatively, if CDR-3 were coded for by the V gene, then the recombination of V with J may provide an opportunity to introduce mutations in CDR-3. In this case the linkage of amino acids in CDR-3 and the J segments would suggest that recognition signals are used such that certain V genes only pair with a given J gene.

Amino Acid Sequence↗
PubMed1976

Linkage of the pig main histocompatibility complex and the J blood group system.

Linkage of the main histocompatibility complex (MHC) and the J blood locus was demonstrated in pgis by means of segregation data in families of double back-cross matings. A recombination frequency of 9.82% was estimated. No evidence of close association with the blood group systems A, B, D, E, F, G, H, I, K, L, M, N and O was found.

Animals↗
PubMed1978

Characterization and mapping of RNase T1-resistant oligonucleotides derived from the genomes of Akv and MCF murine leukemia viruses.

T1 RNA fingerprints of the genomes of Akv-1 and Akv-2 C-type viruses are indistinguishable and oligonucleotide maps of these viruses are probably the same. Akv-1 and -2 share 55--75% of their large T1-resistant oligonucleotides with four MCF viruses isolated from AKR mice or from NIH Swiss mice that inherit either the Akv-1 or Akv-2 virus-inducing locus of AKR. The majority of Akv oligonucleotides missing from T1 fingerprints of MCFs and the majority of oligonucleotides unique to MCF viruses are clustered and lie at corresponding positions in the 3' half of the oligonucleotide maps of Akv and MCF viruses. The RNA sequences present in different MCF isolates but not present in Akv-viruses are related. These results are consistent with a recombinational origin of MCF viruses, as proposed by Hartley and Rowe and their collaborators.

Chromosome Mapping↗
PubMed1979

DNA repair in Proteus mirabilis. VI. Plasmid (R46-) mediated recovery and UV mutagenesis.

The expression of plasmid R46-mediated recovery and mutagenic function (s) was studied in P. mirabilis, which is normally either weakly or non-mutable after UV exposure. The plasmid was found to confer on P. mirabilis enhanced UV resistance as well as UV-induced mutability for various types of forward mutations and reversion of the thr273 mutation. The plasmid enhanced survival of UV-irradiated phages in P. mirabilis both in unirradiated host cells and with increased efficiency after UV-exposure of host cells, as is characteristic of UV-inducible phage reactivation. Spontaneous mutability of P. mirabilis harboring R46 was about 2 to 7 times higher than that of cells without plasmid, depending on the marker, repair type, and plating density of the cells used. All of these R46-mediated rescue and mutagenic functions require the rec672 + gene function. It is assumed that the plasmid R46 adds functions to P. mirabilis comparable to those deficient in umuC and uvm mutants of E. coli (Kato and Shinoura, 1977; Steinborn, 1978) and that P. mirabilis possesses functions homologous to those controlled in E. coli by the recA + and lexA + genes. The significance of plasmid-mediated rescue and mutagenic functions for bacteria which lack the misrepair branch of mutagenesis, is discussed.

Animals↗
PubMed1978

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.

Base Sequence↗
PubMed1978

Large T1 oligonucleotides of Moloney leukemia virus missing in an env gene recombinant, HIX, are present on an intracellular 21S Moloney viral RNA species.

HIX, a recombinant derived from Moloney leukemia virus, has an envelope glycoprotein different from that of the Moloney virus. HIX and Moloney viruses share the majority of the large T1 oligonucleotides derived from their genomes but each possesses a set of distinctive oligonucleotides that lie clustered in corresponding regions in the 3' halves of their oligonucleotide maps. These regions presumably contain envelope glycoprotein coding sequences. The type C viral envelope glycoprotein is believed to be translated from a 21S RNA. Thus, at least part of the region of the Moloney virus genome that is altered relative to HIX was expected to be present on such a species. To test this prediction, we purified an intracellular 21S Moloney viral RNA species and analyzed its large T1 oligonucleotides by two-dimensional polyacrylamide gel electrophoresis. This RNA contains one T1 oligonucleotide that is probably derived from the 5' end of the Moloney virus genome, the Moloney virus T1 oligonucleotides that are missing in HIX, and those that lie to their 3' side on the Moloney virus T1 oligonucleotide map.

Genes, Viral↗