PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “VSV”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources
PubMed1976

Synthesis of RNA by mutants of vesicular stomatitis virus (Indiana serotype) and the ability of wild-type VSV New Jersey to complement the VSV Indiana ts G I-114 transcription defect.

The ability of certain vesicular stomatitis virus (VSV; Indiana serotype) temperature-sensitive (ts) mutants to synthesize intracellular viral complementary RNA (vcRNA) at permissive or nonpermissive temperatures for productive infections has been investigated. Mutants belonging to complementation groups II, III, and V synthesize RNA at nonpermissive temperature in amounts essentially equivalent to that obtained at permissive temperatures. Mutant ts G I-114 possesses a thermolabile transcriptase and does not synthesize vcRNA at 40 degrees C; however, mutants ts O I-5, O I-53, O I-78, and O I-80 possess thermostabile transcriptases that are capable of some vcRNA synthesis at 40 degrees C. All five group I mutants are defective in their secondary transcription ability at 40 degrees C. Wild-type VSV New Jersey virus is able to complement the transcription defect of ts G I-114 at 40 degrees C. This complementation is inhibited by puromycin, suggesting that a viral gene product of VSV New Jersey (e.g., its transcriptase or a transcriptase component) is involved. Mokola virus is not able to complement the ts G I-114 defect, although Mokola does synthesize vcRNA in infected cells (in the presence or absence of cycloheximide).

Cycloheximide↗
PubMed1979

Antibody-independent neutralization of vesicular stomatitis virus by human complement. II. Formation of VSV-lipoprotein complexes in human serum and complement-dependent viral lysis.

Vesicular stomatitis virus (VSV) is efficiently neutralized by normal, nonimmune human serum without the participation of antibody. Neutralization is complement- (C) dependent and requires the early-acting components of the classical pathway, C1, C4, C2, and C3, but not later-acting C components. In further studies, normal human serum was found to markedly increase the density of a variable but significant proportion of virus-associated RNA and to markedly decrease the density of the remainder of virus-associated RNA. The RNA of increased density was found to be dense ribonucleocapsid cores released from VSV by C-dependent viral lysis mediated through the classical pathway. The released ribonucleocapsid cores found at the bottom of sucrose density gradient after incubation of VSV with human serum were resistant to degradation by proteolytic enzymes. The VSV-derived RNA found floating on the tops of sucrose density gradients performed on serum-treated VSV was infectious virus. The decreased density was due to binding of VSV to human serum lipoproteins (LP), primarily very low density lipoproteins (VLDL). Binding of VLDL to VSV required the presence of the viral envelope and the external glycoprotein, G. Despite the binding of LP to VSV, LP did not neutralize VSV, and LP-depleted sera were fully active in neutralizing VSV. Thus, LP do not represent an accessory factor for the C-dependent neutralization of VSV.

Antibodies, Viral↗
PubMed1978

Properties of the viruses selected during persistent infection of L cells with VSV.

Two virus clones, VSV-mp and VSV-sp, were isolated from L cells persistently infected with VSV (New Jersey serotype). Both clones were more temperature sensitive than the parent virus, VSV-o, and grew more slowly, gave smaller plaques, less c.p.e. and lower virus yields in L cells. Unlike the parent virus, both persistent viruses induced interferon production in L cells. Stable carrier cultures could be obtained from L cells infected with VSV-sp at low multiplicities without pretreatment with interferon. This may be related to the fact that VSV-sp is more sensitive to interferon than either VSV-mp or VSV-o.

Cell Fusion↗
PubMed1977

SV40 tumor rejection induced by vesicular stomatitis virus bearing SV40 tumor-specific transplantation antigen (SV40-TSTA). II. Association of SV40-TSTA activity with liposomes containing VSV glycolipids.

Highly purified vesicular stomatitis virus (VSV) was obtained from VSV-infected SV40-transformed and from "normal" hamster cell lines. A glycolipid extract was prepared from these VSV preparations according to the Folch partition procedure. These glycolipids were rendered immunogenic to the Syrian hamsters when incorporated within liposomal membranes composed of lecithin/sphingomyelin/cholesterol (1/1/2 by weight). When the glycolipids were extracted from VSV grown on cell lines (TSV5-cl2 and EHSVi-cl1) which contained the SV40 tumor-specific transplantation antigen (SV40-TSTA), it was possible either to induce a tumor rejection or at least to slow the growth of the tumor in Syrian hamsters challenged with TSV5-cl2 cells. No protection was obtained in animals treated with liposomes containing glycolipids extracted from purified VSV grown on SV40-TSTA-negative cells (EHB). The SV40-TSTA could be a glycolipid of the transformed cell membrane which is incorporated within the VSV envelope.

Animals↗
PubMed1976

Polykaryocyte formation induced by VSV in mouse L cells.

Infection of mouse L cells with VSV leads to the formation of polykaryocytes about 4 to 12 h p.i. When anti-VSV immune serum was added during the course of infection, progression of cell fusion was soon suppressed. Cycloheximide completely suppressed the cell fusion when the drug was added within 1 h p.i., while the cell fusion was not suppressed at all when the drug was added at and after 3 h. Early polykaryocyte formation, 'fusion from without', was observed only at a low level in cells infected at very high multiplicities. The development of cell fusion induced by VSV was found to be different in several cell types, although all these cells produced a rather high yield of virus: L and C-243-3 mouse cell lines showed a high level of polykaryocytosis (80 to 100%), BHK and RK-13 cells responded at low level, and PS and Vero cells showed no cell fusion in response to VSV infection. In PS cells, however, cell fusion occurred when VSV-infected L cells were co-cultivated. From these observations, the mechanism of cell fusion induced by VSV was discussed.

Animals↗
PubMed1992

Infectious defective interfering particles of VSV from transcripts of a cDNA clone.

The generation of infectious defective interfering (DI) particles of vesicular stomatitis virus (VSV) entirely from cDNA clones is reported. Bacteriophage T7 RNA polymerase was used to direct the transcription of a complete negative-stranded genomic RNA from a cDNA clone of a VSV DI RNA in cells simultaneously expressing the five VSV proteins from separately transfected cDNA clones. The negative-stranded transcript was encapsidated with N protein, replicated by the VSV polymerase, and the replicated RNAs were assembled and budded to yield infectious DI virions. No helper VSV was required. Replication occurred at high levels and was assayed by direct biochemical means. An exact 3' terminus of the initial transcript, which was generated by autolytic cleavage using a ribozyme from hepatitis delta virus, was critical for replication.

Base Sequence↗
PubMed1977

Studies of L cells persistently infected with VSV: factors involved in the regulation of persistent infection.

Infection of interferon-treated L cells with VSV led frequently to the establishment of L cells persistently infected with VSV (LVSV cells). These cells were characterized by the following properties; (I) no supplement of antiviral factors such as anti-VSV antiserum, interferon, was required for their maintenance; (2) virus antigens were detected in about 5 to 30% of the cells by immunofluorescence staining; (3) the cells were not only resistant to superinfection by homologous virus, but also resistant to challenge by heterologous viruses such as Mengo virus; (4) the cells were destroyed by co-cultivation with heterologous cells susceptible to VSV infection; (5) the cells could be cured by serial cultivation in medium containing antiviral antibody, and the cured cells were as susceptible to VSV as normal L cells. It was shown that at least three factors (interferon, defective interfering [DI] particles and a selection of small-plaque temperature-sensitive [ts] mutants) took part in the maintenance of LVSV cells although it was difficult to evaluate exactly the relative importance of these factors. The effect of antiviral antibody, interferon and incubation temperature upon the maintenance of LVSV cells are discussed further.

Animals↗
PubMed1991

Fatty acid acylation is not required for membrane fusion activity or glycoprotein assembly into VSV virions.

We have investigated the role of fatty acid acylation on two properties of the glycoprotein (G protein) from the Indiana serotype of vesicular stomatitis virus (VSV). Using a mutated G protein described previously (CS-2) that is not palmitylated, we found that fatty acid acylation was not required for the low pH-induced membrane fusion activity of VSV G protein. Transient expression of CS in HeLa cells resulted in syncytia formation that was indistinguishable from that induced by wild-type G protein. In addition, we found that expression of CS complemented a temperature-sensitive mutant of VSV (tsO45) as well as the wild-type protein. These results indicate that the presence of palmitate on the cytoplasmic domain of VSV G protein is not required for any step in the life cycle of the virus.

Acylation↗
PubMed1978

Specific changes in the oligosaccharide moieties of VSV grown in different lectin-resistnat CHO cells.

The carbohydrate moieties of the G glycoprotein of vesicular stomatitis virus (VSV) grown in three distinct lectin-resistant (LecR) Chinese hamster ovary (CHO) cell lines have been compared by fine structural analysis of radiolabeled glycopeptides. The mutant WgaRIII, selected for resistance to wheat germ agglutinin (WGA), produces VSV containing G glycoprotein specifically lacking in sialic acid. The mutant PhaRI, selected for resistance to phytohemagglutinin (PHA) and previously shown to lack a particular glycoprotein N-acetyl-glucosaminyl-transferase activity, produces VSV containing G glycoprotein specifically lacking terminal N-acetylglucosamine-galactose-sialic acid sequences and possessing an increased number of mannose residues in the "core" region of its carbohydrate moieties. The mutant PhaRIConARII, a "double" mutant selected from PhaRI cells for resistance to concanavalin A (ConA), produces VSV containing G glycoprotein with a further alteration in the mannose residues of the "core" oligosaccharide region. We discuss the relevance of these findings to the mechanisms of glycoprotein biosynthesis in mammalian cells and to the biochemical bases of lectin resistance in CHO cells.

Cell Line↗
PubMed1979

Defective interfering particles modulate VSV infection of dissociated neuron cultures.

Infection of dissociated neuron cultures of mice with VSV and its defective particle DI-T was studied using fluorescent light microscopy as well as transmission and scanning electron microscopy. When cultures are infected with wild virus, VSV replicates selectively in neurons, producing cell death within 24-48 hr. Sensory and immature neurons express viral antigen most rapidly. Viral antigen and viral budding sites are detected along the neuron soma and dendrites. When large amounts of DI-T particles are added to the wild virus inoculum, viral growth is completely suppressed in mature neurons, the cell killing effects of VSV are considerably delayed and co-infected cultures survive for 5-16 days. Viral antigen accumulates in cytoplasmic inclusions and on the membrane of neuron cell somas and dendrites in the virtual absence of viral assembly. Identical modulation of VSV infection in mature neuron cultures is obtained when DI-T particles are added before or after the wild virus, but ultraviolet inactivation of DIs completely abolishes their protective effect. Immature neurons or Vero cells cannot be protected from acute cytopathic changes by an equivalent amount of DI particles. Thus DIs interfere with replication and assembly of the wild virus and attenuate cell killing effects in mature neurons in vitro.

Animals↗
PubMedDate not supplied

Electrostatic interactions in the early events of VSV infection.

The importance of electrostatic interactions in the early phases of vesicular stomatitis virus (VSV) infection has been investigated in susceptible cells of different origin, human (HeLa) and avian (CER), by using some polyanions (heparin, polygalacturonic acid and mucin) and polycations (polymyxin B sulphate, poly-L-lysine, protamine, histone and polybrene). In HeLa cells, the attachment of VSV was enhanced by polymers having a positive charge and inhibited by those having a negative charge. In CER cells, all the polyanions tested reduced virus infection. Among the polycations, histone, polymyxin B sulphate and poly-L-lysine enhanced virus plaque formation while protamine and polybrene reduced virus attachment. The effect of polyions on VSV particles and on cell membrane receptors has also been investigated. The analysis of the results obtained suggest that, although electrostatic interactions play an essential role in the binding of VSV to the cell membrane, more specific structural features appear to be required for viral attachment to occur.

Animals↗
PubMedDate not supplied

[Formation of pseudotypes of VSV after culture in a human melanoma].

Electron microscope studies showed a high production of melanosomes and viral particles budding into the cisternae of the endoplasmic reticulum in cells derived from a subcutaneous metastasis. The history of this subline (HM6B-A) has been summarized elsewhere. An amelanotic subline (provided by the same patient) did not show similar virus particles. When infected with a vesicular stomatitis virus (VSV) thermolabile mutant (tl), these cells produced a VSV pseudotype in which a thermosensitive antigen was modified. Modification of surface VSV antigens was also detected by neutralisation tests. Using these tests, the VSV-pseudotype particles could be used as a tool to detect one or more antigens to a "putative" human melanomavirus, which might be only partially expressed.

Antigens, Viral↗
PubMed1991

Role of membrane phospholipids and glycolipids in cell-to-cell fusion by VSV.

To identify membrane components of CER cells interacting with vesicular stomatitis virus (VSV) during fusion at acidic pH (fusion from without, FFWO) two different approaches have been used, i.e. (i) treating the whole cells with enzymes and (ii) testing the ability of isolated membrane molecules to interfere with FFWO. Phospholipase A2 and C digestion of cells greatly reduced syncytia formation, pointing towards the involvement of lipid structures as target sites for VSV. Cell susceptibility to FFWO was also reduced after neuraminidase, beta-galactosidase or periodate treatment, suggesting that carbohydrate residues may participate in a complex receptor structure required for virus fusion. When membrane molecules were examined separately for their ability to inhibit viral FFWO, phosphatidylserine, phosphatidylinositol, sphingomyelin, cholesterol and GM3 ganglioside were found to be active, confirming the role of membrane lipid moiety in the cell surface structures involved in the early phases of VSV infection.

Cell Fusion↗
PubMed1991

Alteration of specific amino acid residues in the acidic domain I of VSV phosphoprotein (P) converts a GAL4-P(I) hybrid into a transcriptional activator.

As part of a study of transcriptional regulation by viral proteins, we examined whether an acidic region from a regulatory protein of an RNA virus could function as a trans-activator. The NH2-terminal highly acidic domain I of the phosphoprotein (P) of vesicular stomatitis virus (VSV) was fused to the DNA-binding domain of the yeast trans-activator, GAL4. In transient transfection assays, the resulting chimeric protein failed to activate transcription of a reporter CAT gene. However, mutation of basic amino acid residues located at positions 6 and 8 or the alteration of eight amino acids within the acidic domain to eight different amino acids converted the chimeric protein into a transcriptional activator comparable to wild-type GAL4. When subjected to SDS-polyacrylamide gel electrophoresis, the P proteins containing trans-activation-positive mutations in domain I showed an altered mobility, suggesting that these mutations may have caused a conformational change that is critical for trans-activation. Since the acidity of P domain I is not sufficient to activate transcription, additional features of this region must play an important role in GAL4-mediated trans-activation. None of the trans-activation-positive mutants supported VSV RNA transcription in vitro. These results suggest that the amino acid residues within P domain I that can be made to function in the trans-activation of DNA-dependent RNA transcription are distinct from those involved in VSV RNA-dependent RNA transcription.

Amino Acid Sequence↗
PubMed1977

Glycosylation of VSV glycoprotein is similar in cystic fibrosis, heterozygous carrier, and normal human fibroblasts.

The single envelope glycoprotein of vesicular stomatitis virus was used as a specific probe of glycosyltransferase activities in fibroblasts from two cystic fibrosis patients, an obligate heterozygous carrier and a normal individual. Gel filtration of pronase-digested glycopeptides from both purified virions and infected cell-associated VSV glycoprotein which had been labeled with[3H] glucosamine did not reveal any significant differences in the glycosylation patterns between the different cell cultures. All 4 cell lines were apparently able to synthesize the mannose- and glucosamine- containing core structure and branch chains terminating in sialic acid which are characteristic of asparagine-linked carbohydrate side chains in cellular glycoproteins. Analysis of tryptic glycopeptides by anion-exchange chromotography indicated that the same 2 major sites on the virus polypeptide were recognized and glycosylated in all 4 VSV-infected cell cultures. These studies suggest that the basic biochemical defect(s) in cystic fibrosis is not an absence or deficiency in enzymes responsible for the biosynthesis of complex carbohydrate side chains.

Cell Line↗
PubMed1978

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.

Base Sequence↗
PubMed1978

Pseudotype particles of vesicular stomatitis virus with surface antigens of bovine leukaemia virus--VSV (BLV) -- as a sensitive probe for detecting antibodies in the sera of spontaneously infected cattle.

Phenotypically mixed particles containing the genome of vesicular stomatitis virus (VSV) and envelope antigen corresponding to bovine leukaemia virus (BLV) -- the VSV (BLV) pseudotypes -- can be employed as a rapid, specific and sensitive probe for detecting BLV-neutralizing antibodies in bovine sera.

Animals↗