PubMed Health⌕ Search

Biomedical subjects

A L Kenter

Publications and source records attributed to A L Kenter.

At least 19 recordsLinked to original sources
PubMed2005

Class switch recombination: an emerging mechanism.

Class switch recombination (CSR) has been the least well understood of the Ig gene DNA rearrangements. The discovery that activation-induced deaminase (AID) is a pivotal player in CSR as well as somatic hypermutation (SHM) and its variant, gene conversion, represents a sea change in our understanding of these processes. The recognition that AID directly deaminates ssDNA has provided a springboard toward the emergence of a model that explains the initiation of these events. Nonhomologous end joining (NHEJ), the main pathway for the repair of double-strand breaks in mammalian cells plays a key role in the resolution of CSR transactions. Mediators of general double-strand break repair are also involved in CSR and are mutated in several immunodeficiency diseases. A global picture of the mechanism of CSR is emerging and is providing new insights toward understanding the genetic events that underlie B cell cancers.

Animals↗
PubMed2001

NF-kappa B p50-dependent in vivo footprints at Ig S gamma 3 DNA are correlated with mu-->gamma 3 switch recombination.

NF-kappa B has been demonstrated to play critical roles in multiple aspects of immune responses including Ig H chain isotype switching. To better define the specific roles the p50 subunit of NF-kappa B plays in mu-->gamma 3 switch recombination (SR), we systematically evaluated p50-deficient B cells for activities that are strongly correlated with SR. B cell activation with LPS plus anti-IgD-dextran plus IL-5 plus IL-4 plus TGF-beta produced normal levels of proliferation and gamma3 germline transcripts in p50-deficient B cells, but mu-->gamma 3 SR was impaired. In vitro binding studies previously showed that NF-kappa B p50 homodimer binds the switch nuclear B-site protein (SNIP) of the S gamma 3 tandem repeat. Ligation-mediated PCR in vivo footprint analysis demonstrates that the region spanning the SNIP and switch nuclear A-site protein (SNAP) binding sites of the S gamma 3 region are contacted by protein in normal resting splenic B cells. B cells that are homozygous for the targeted disruption of the gene encoding p50 (-/-) show strong aberrant footprints, whereas heterozygous cells (+/-) reveal a partial effect in S gamma 3 DNA. These studies provide evidence of nucleoprotein interactions at switch DNA in vivo and suggest a direct interaction of p50 with S gamma 3 DNA that is strongly correlated with SR competence.

Animals↗
PubMed2000

Evidence for class-specific factors in immunoglobulin isotype switching.

Immunoglobulin class switch recombination (SR) occurs by a B cell-specific, intrachromosomal deletional process between switch regions. We have developed a plasmid-based transient transfection assay for SR to test for the presence of transacting switch activities. The plasmids are novel in that they lack a eukaryotic origin of DNA replication. The recombination activity of these switch substrates is restricted to a subset of B cell lines that support isotype switching on their endogenous loci and to mitogen-activated normal splenic B cells. The factors required for extrachromosomal plasmid recombination are constitutively expressed in proliferating splenic B cells and in B cell lines capable of inducibly undergoing immunoglobulin SR on their chromosomal genes. These studies suggest that mitogens that induce switching on the chromosome induce accessibility rather than switch recombinase activity. Finally, we provide evidence for two distinct switching activities which independently mediate mu-->alpha and mu-->gamma3 SR.

Animals↗
PubMed1999

Switch recombination in a transfected plasmid occurs preferentially in a B cell line that undergoes switch recombination of its chromosomal Ig heavy chain genes.

Ab class switching is induced upon B cell activation in vivo by immunization or infection or in vitro by treatment with mitogens, e. g. LPS, and results in the expression of different heavy chain constant region (CH) genes without a change in the Ab variable region. This DNA recombination event allows Abs to alter their biological activity while maintaining their antigenic specificity. Little is known about the molecular mechanism of switch recombination. To attempt to develop an assay for enzymes, DNA binding proteins, and DNA sequences that mediate switch recombination, we have constructed a plasmid DNA substrate that will undergo switch recombination upon stable transfection into the surface IgM+ B cell line (I.29 mu), a cell line capable of undergoing switch recombination of its endogenous genes. We demonstrate that recombination occurs between the two switch regions of the plasmid, as assayed by PCRs across the integrated plasmid switch regions, followed by Southern blot hybridization. Nucleotide sequence analysis of the PCR products confirmed the occurrence of S mu-S alpha recombination in the plasmid. Recombination of the plasmid in I.29 mu cells does not require treatment with inducers of switch recombination, suggesting that recombinase activity is constitutive in I.29 mu cells. Recombination does not require high levels of transcription across the switch regions of the plasmid. Fewer recombination events are detected in four different B and T cell lines that do not undergo switch recombination of their endogenous genes.

Animals↗
PubMed1997

Ig Sgamma3 DNA-specifc double strand breaks are induced in mitogen-activated B cells and are implicated in switch recombination.

The looping-out and deletion model of switch recombination suggests that double strand breaks (DSBs) may occur in switch regions and participate in the recombination transaction. A DSB assay based on the ligation-mediated PCR method has been devised for the Sgamma3 region. Mitogen-inducible DSBs have been detected in Sgamma3 DNA of normal splenic B cells but not in splenic T cells or thymocytes. The breaks are restricted to the Sgamma3 region and are sequence specific. Examination of the sequence surrounding the DSBs has led to the derivation of a consensus sequence for DSB formation. Induction of Sgamma3-specific DSBs is correlated with the onset of switch recombination. The DSBs flank clusters of Sgamma3 recombination breakpoints, suggesting that processing of the broken ends may occur during the recombination reaction.

Animals↗
PubMed1997

Analysis of immunoglobulin Sgamma3 recombination breakpoints by PCR: implications for the mechanism of isotype switching.

The molecular mechanism of immunoglobulin switch recombination is poorly understood. Switch recombination occurs between pairs of switch regions located upstream of the constant heavy chain genes. Previously we showed that switch recombination breakpoints cluster to a defined subregion in the Sgamma3, Sgamma1 and Sgamma2b tandem repeats. We have developed a strategy for direct amplification of Smu/Sgamma3 composite fragments as well as Smu and Sgamma3 regions by PCR. This assay has been used to analyze the organization of Smu, Sgamma3 and a series of Smu/Sgamma3 recombination breakpoints from hybridomas and normal mitogen-activated splenic B cells. DNA sequence analysis of the switch fragments showed direct joining of Smu and Sgamma3 without deletions or duplications. Mutations were found in two switch junctions on both sides of the crossover point, suggesting that template switching is the most likely model for the mechanism of switch recombination. Statistical analysis of the positions of the recombination breakpoints in the Sgamma3 tandem repeat indicates the presence of two sub-clusters, suggesting non-random usage of DNA substrate in the recombination reaction.

Animals↗
PubMed1997

Ig S gamma-specific DNA binding protein SNAP is related to the helix-loop-helix transcription factor E47.

SNAP, a DNA-binding protein, is specific for the S gamma switch regions. Two E-2 box consensus binding motifs are located within the SNAP recognition site. Direct- and competition-binding analyses demonstrate that a truncated form of the E47 transcription factor, E47S, is capable of specific interactions with the SNAP binding motif. The methylation interference pattern for E47S binding on the pl.S gamma 3.A.1 probe was similar to that previously obtained for SNAP binding activity and was also related to that found for E47S on the microE5 probe. The interaction of purified E47S with the SNAP recognition motif was cooperative and formed complexes which migrated more slowly than the E47S homodimer complex. SNAP is distinguished from full-length E47 homodimers, found in BCF-1, by its migration position in the gel shift assay, differences in the competition-binding results and its unique reactivity with anti-E47 antibodies. SNAP is related to E47 as judged by a similar methylation interference pattern on S gamma 3 A site DNA and by its reactivity with anti-E47 mAb. The anti-E47 antibodies block SNAP binding to its cognate site, whereas anti-E47 antibodies supershift E47 homodimers bound to the microE5 recognition site. Thus, SNAP may be a hetero-oligomeric species containing E47 or highly related proteins.

Animals↗
PubMed1995

Mitogen activation of a nuclear alkaline phosphatase in normal activated lymphocytes.

B cell differentiation is punctuated by V(D)J joining in the heavy chain of the pro-B cell, VJ joining in the light chain of the pre-B cell, switch recombination, and somatic hypermutation in the mature B cell. The regulatory signals controlling these events and the developmental program leading to them is poorly understood. We have identified a new phosphatase activity that is expressed in lymphocytes and for which high expression is restricted to mature B cells. This new phosphatase is transiently expressed in nuclear extracts of mitogen-activated splenic B cells. The phosphatase is a monoesterase that is active on both dNMPs and pNPP. The phosphatase has been partially purified by column chromatography and is inhibited by orthovanadate, molybdate, tetramisole, and EDTA and requires Mn2+ for activation. Monoesterase activity requires a pH above the neutral range. The activity profile in the presence of the inhibitors and the requirement for basic pH suggest that this enzyme is an alkaline phosphatase.

Alkaline Phosphatase↗
PubMed1993

Switch recombination breakpoints occur at nonrandom positions in the S gamma tandem repeat.

Ig switch (S) recombination is clearly focused on S regions. It is possible that S-specific DNA binding proteins facilitate the alignment of these regions before recombination. The S gamma 3-specific DNA binding proteins, SNAP and SNIP/NF-kappa B, interact with two discrete regions of the S gamma 3 tandem repeat, the A and B sites. Recombination breakpoints in the S gamma 3 region were found to significantly correlate with the binding sites of the S gamma 3 binding proteins. We now report the conservation of the SNIP and SNAP binding sites in S gamma 2b and S gamma 1 DNA. SNIP/NF-kappa B interacts with its cognate sites in S gamma 2b and S gamma 1 DNA as determined by mobility shift assays, competition binding studies, and supershift analysis using an antiserum specific for the p50 component. SNAP binds specifically to S gamma 2b and S gamma 1 as measured by mobility shift assays and competition binding studies. SNAP is composed of two closely traveling mobilities that do not separate on partial purification. SNIP and SNAP are expressed in nuclear extracts derived from murine splenic B cell cultures stimulated with mitogen or mitogen and IL-4. No new DNA binding proteins specific for S gamma 1 tandem repeats are detectable in nuclear extracts from B cells stimulated with mitogen and IL-4. The sites at which recombination occurs in the S gamma 2b and S gamma 1 regions have been analyzed statistically and found to correlate with the SNIP/NF-kappa B and SNAP binding sites. Distinctions have been found regarding the use of DNA substrates within the tandem repeat between primary (mu-->gamma) and successive (gamma-->x) S recombination.

Animals↗
PubMed1992

Switch recombination breakpoints are strictly correlated with DNA recognition motifs for immunoglobulin S gamma 3 DNA-binding proteins.

The deletion looping out model of switch (S) recombination predicts that the intervening DNA between switch regions will be excised as a circle. Circular excision products of immunoglobulin switch recombination have been recently isolated from lipopolysaccharide (LPS)-stimulated spleen cells. The recombination breakpoints in these large circles were found to fall within switch regions. Since switch recombination is clearly focused on switch regions, we hypothesized that some DNA-binding protein factor might be involved in specifically recognizing and facilitating the alignment of switch regions before recombination. Two DNA-binding proteins that specifically interact with two discrete regions of the S gamma 3 tandem repeat have been identified in crude and partially purified nuclear extracts derived from LPS- and dextran sulfate (DxS)-activated splenic B cells. The first factor has been found indistinguishable from NF-kappa B by mobility shift assays, methylation interference, competition binding studies, and supershift analysis using an antiserum specific for the p50 component. The second appears to be composed of two closely traveling mobilities that do not separate upon partial purification. This second complex is unique and specific for S gamma 3 by methylation interference assays and competition-binding analysis. The sites at which recombination occurs in the S gamma 3 switch region have been analyzed and found to strictly correlate with the binding sites of the S gamma 3 switch binding proteins.

Amino Acid Sequence↗
PubMed1991

High expression of a 3'----5' exonuclease activity is specific to B lymphocytes.

V(D)J joining, the immunoglobulin heavy-chain (IgH) class switch, and somatic hypermutation directed at variable regions are unique genetic recombination or mutation events which occur during B-cell differentiation. The enzymatic process directing and controlling these events remains obscure. An assay for exonucleolytic activity has been devised, and an exonuclease activity expressed at high levels in normal B lymphocytes has been detected. The high expression of this enzyme is specific to B lymphocytes and may be developmentally regulated. We have partially purified a B-cell-associated nuclease by column chromatography. Using this preparation, we have begun a rigorous analysis of its activity. This activity is a nonprocessive, 3'----5' exonuclease with a requirement for divalent cations. Our studies demonstrate that EDTA, poly(dI-dC), and glycerol are all inhibitory to B-cell-associated exonucleolytic activity. The exonuclease displays sequence preference but no sequence specificity when tested on a variety of native DNA substrates. This nuclease is distinct from other exonuclease activities previously described.

Animals↗
PubMed1990

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.

Animals↗
PubMed1987

Cell cycle kinetics model of LPS-stimulated spleen cells correlates switch region rearrangements with S phase.

The cell cycle kinetics of lipopolysaccharide (LPS)-stimulated spleen cells were measured by acridine orange (AO) staining and flow cytometry. We have devised a computer model to predict the proportions of cells in each cell cycle phase using iteratively varied parameters. The optimum fit between the predicted and observed proportions of cells in various phases of the cell cycle was determined using the minimum sigma chi 2. The model then correlates the variability of intermitotic phase time with the proportion of genomic DNA available for immunoglobulin (Ig) switch region (S mu) rearrangement. This analysis predicts that rearrangements at S mu are cell cycle-dependent events which occur during the first S phase after LPS activation. Molecular analysis of this system confirms these predictions.

Animals↗
PubMed1986

Colcemid inhibits growth during early G1 in normal but not in tumorigenic lymphocytes.

Mitogenically stimulated human and mouse lymphocytes enter the cell cycle (G0, G1A, G1B, S, G2+M) via a newly recognized subphase, G1'. This subphase precedes G1A and is distinct from G0. The G1' subphase is absent in immortalized and tumorigenic lymphoblastoid cell lines (LCLs) by cytofluorimetric criteria. Furthermore, colcemid inhibits transition through the G0/G1' as well as G2 phases in mitogen-stimulated lymphocytes and in LCLs. Tumorigenic LCLs are not sensitive to growth inhibition by colcemid during early G1. These observations suggest that a progressive series of changes have occurred during G0/G1' which lead to deregulation of growth control.

Animals↗
PubMed1984

Mouse myeloma cells that make short immunoglobulin heavy chains: pleiotropic effects on glycosylation and chain assembly.

Two variants in immunoglobulin heavy chain production, derived from the MPC 11 mouse myeloma cell line, make short heavy (H) chains with identical precise deletions of the CH3 domain. The CH3 domain is expressed in the H chain mRNA from both variants. Although in vitro translation of this mRNA produces one H chain species, deleted heavy chains are secreted as heavy-light (HL) and H2L2 moieties in contrast to MPC 11, which secretes only H2L2 . The heavy chains of HL apparently contain more carbohydrate (CHO+) than do the H chains of H2L2 , and inhibition of N-linked glycosylation results in the secretion of relatively more H2L2 . Here we present evidence suggesting that (a) the absence of the CH3 domain has led to conformational changes in these molecules, (b) these changes permit posttranslational glycosylation, and (c) unrestrained glycosylation can frequently yield unusual CHO+ structures that make complete assembly unlikely.

Amino Acid Sequence↗