PubMed Health⌕ Search

Biomedical subjects

A N Lane

Publications and source records attributed to A N Lane.

At least 55 records · Page 3Linked to original sources
PubMed1995

Determination of fast dynamics of nucleic acids by NMR.

Double-stranded oligonucleotides of < 10 base pairs are adequately described as an isotropic rotor, using the correlation time for the cytosine H6-H5 vector. For longer fragments, the cylindrical model should be used for detailed analysis of NOEs. The appropriate correlation times can be calculated using the formulae of Tirado and Garcia de la Torre or derived from measurements of the cross-relaxation rate constants for cytosine (or uridine) H6-H5. Order parameters describing the degree of motion of different vectors on the subnanosecond time scale vary substantially, with typical values of S2 > 0.8 for base vectors and 0.5-0.8 for intrasugar and base-sugar vectors. Order parameters for terminal nucleotides are typically significantly smaller than for internal nucleotides, which may also mean that their conformation will be less well determined in the formalism of a unique structure. The CSA relaxation rates of the phosphodiesters appear to be insensitive to internal motions and may, therefore, provide the most accurate estimate of the overall tumbling time in nucleic acid fragments. Using a combination of relaxation data for different nuclei and different spectrometer frequencies may be expected to yield detailed information about fast motions in nucleic acid fragments.

Anisotropy↗
PubMed1994

Thermodynamic stability and solution conformation of tandem G.A mismatches in RNA and RNA.DNA hybrid duplexes.

G.A mismatches form a variety of hydrogen-bonded structures in DNA, most of which destabilise the duplex. Tandem G.A mismatches in the context YGAR (Y = pyrimidine, R = purine), however, form base pairs using the amino group of the guanine residue [Li, Y., Zon. G. & Wilson, W.D. (1991) Proc. Natl Acad. Sci. USA 88, 26-30], which permits extensive base-base stacking, leading to a slight stabilisation of the helix [Ebel, S., Lane, A. N. & Brown, T. (1992) Biochemistry 31, 12083-12086]. We have measured the thermodynamic stability of several RNA and RNA.DNA hybrid duplexes containing tandem G.A mismatches. The RNA duplexes are intrinsically much more stable than the corresponding DNA duplexes and the mutations are destabilising in all cases. NOE and coupling-constant data show that all of the sugars are in the C3'-endo range of conformations, and glycosidic torsion angles are in the range -160 degrees to -180 degrees in [sequence: see text]. Both sequential NOE intensities and circular-dichroism measurements indicate that the global conformation of the mismatched RNA is A-like. The N1H group of the mismatched guanine residue is not involved in hydrogen bonding with the adenine residue, indicating the presence of the amino-pairing scheme. Determination of the structure using 'loose' NMR-derived constraints shows that the potential energies of the imino-paired and amino-paired forms are similar, but substantially higher than energy-minimised RNA. Using tighter constraints derived from more extensive analysis of one-dimensional and two-dimensional NOE data showed that the amino-paired structure agrees with the constraint data better than the imino-paired structure, and also accounts for unusual chemical shifts and the lack of hydrogen bonding of the guanine N1H group. Resulting molecular models show that the amino-paired mismatches are not as extensively stacked on the neighbouring part of the duplex as in the B-DNA analogues, largely accounting for the lower thermodynamic stability in the RNA duplexes.

Base Sequence↗
PubMed1994

Nuclear magnetic resonance measurements of slow conformational dynamics in macromolecules.

The combined use of rotating-frame relaxation methods, temperature-dependent measurements of line shapes and magnetization transfer experiments allows in favorable cases the examination in some detail of exchange processes that occur on the millisecond time scale. It is possible to determine not only the rate constants, but also the activation parameters and chemical shifts even for events that are in fast exchange on the chemical shift time scale. Such measurements complement the information obtainable from heteronuclear relaxation methods that probe mainly the fast librational motions in macromolecules and may provide information important for functional studies of biological macromolecules.

Amino Acid Sequence↗
PubMed1993

NMR assignments and solution conformation of the DNA.RNA hybrid duplex d(GTGAACTT).r(AAGUUCAC).

Nearly complete assignments of the 1H-NMR spectrum of the DNA.RNA hybrid d(GTGAACTT).r(AAGUUCAC) have been obtained by two-dimensional methods. Three-bond coupling constants measured from cross-sections of two-dimensional NOE spectra and double quantum-filtered correlation spectra showed that the sugars in the DNA strand are predominantly in the S domain of puckers, whereas the ribofuranoses are mainly C3'-endo. Analysis of time-dependent NOE intensities from one- and two-dimensional experiments showed that the glycosidic torsion angles in the DNA strand are near -120 degrees, whereas those in the RNA strand are in the range- 140 degrees to -160 degrees. These nucleotide conformations correspond to those typically found in B-DNA and A-RNA, respectively. The circular dichroism of the duplex is similar to that of A-form RNA, consistent with a global A-like conformation. A large number of duplex structures was generated in which the nucleotides were fixed in the experimentally determined conformations. A subset of these structures was found that satisfied the internucleotide NOE intensities, backbone constraints and had acceptable Lennard-Jones energies. The base pairs in the duplex were found to have positive inclinations, a translation (Dx) of about 0.4 nm from the helix axis, and more than 10 bp/turn on average. This implies a helical structure in the A family of conformations.

Base Sequence↗
PubMed1993

NMR and molecular modeling studies of the interaction of berenil and pentamidine with d(CGCAAATTTGCG)2.

The interaction of two anti-trypanosomal agents, berenil and pentamidine, with the A+T-rich dodecamer d(CGCAAATTTGCG)2 has been examined by high-resolution 1H-NMR, optical spectroscopy, and molecular modeling. Proton assignments for the free DNA and each DNA-ligand complex were obtained using nuclear Overhauser enhancement spectroscopy and total correlation spectroscopy. Complexation induces large changes in chemical shift for protons in the DNA minor groove for the A5-T9 segment, and intermolecular NOEs reveal contacts between the DNA bases and each ligand. The asymmetric binding site for berenil indicated by the NMR data suggests that at least two overlapping sites are involved. Rapid exchange between symmetrically-equivalent binding sites, via dissociative rearrangement, is consistent with retention of twofold degeneracy for both the ligand and the DNA host. Calculations of binding energy confirm that this DNA duplex contains overlapping sites of similar binding affinity. In contrast, the larger pentamidine molecule occupies a site that spans four or five bp, with asymmetric binding to the minor-groove 5'-ATTT sequence. The B-type conformation of the DNA is not altered substantially by either ligand.

Base Sequence↗
PubMed1993

Determination of metabolites by 1H NMR and GC: analysis for organic osmolytes in crude tissue extracts.

World-wide salinity and drought problems necessitate the understanding of biological adaptation to water deficit. Osmotic adjustment via organic solutes is a common strategy for organisms to deal with water deficit problems. Numerous water-soluble organic metabolites across several chemical classes are commonly utilized as osmolytes, including betaines, sulfonium and sulfonate compounds, amino acids, carbohydrates, and polyols. To deal with the complexity and variability in osmolyte composition, we have devised an analytical approach that combines high-resolution 1H NMR and GLC to provide both structure identification and quantification of a broad spectrum of compounds. This combined approach also facilitated direct analyses of crude tissue extracts without extensive sample preparation, making it well-suited for a convenient screening of potential osmolytes. The structures of known osmolytes were confirmed from two-dimensional total correlation 1H NMR spectra, which also yielded structural information about unknown compounds. Five each terrestrial plant and marine animal species were examined for 41 metabolites, including osmolyte candidates glycinebetaine, dimethylsulfoniopropionate, taurine, proline, glycine, asparagine, alanine, glutamine, glucose, and sucrose. The osmotic function of glycinebetaine, proline, asparagine, glutamine, glucose, and sucrose was also demonstrated in leaves of Distichlis spicata under different salinity treatments.

Amino Acids↗
PubMed1993

Interaction of the trp repressor with trp operator DNA fragments.

The interaction of the trp repressor with several trp operator DNA fragments has been examined by DNA gel retardation assays and by circular dichroism, in the absence and presence of the corepressor L-tryptophan. The holorepressor binds stoichiometrically to both the trpO and aroH operators, forming 1:1 complexes. In the presence of excess protein, additional complexes are formed with these operator fragments. The relative electrophoretic mobilities of the 1:1 complexes differ significantly for trp and aroH operators, indicating that they differ substantially in gross structure. A mutant trp operator, trpOc, has low affinity for the holorepressor, and forms only complexes with stoichiometries of 2:1 (repressor: DNA) or higher, which have a very low electrophoretic mobility. Specific binding is also accompanied by a large increase in the intensity of the near ultraviolet circular dichroism, with only a small blue shift, which is consistent with significant changes in the conformation of the DNA. Large changes in the chemical shifts of three resonances in the 31P NMR spectrum of both the trp operator and the aroH operator occur on adding repressor only in the presence of L-tryptophan, consistent with localised changes in the backbone conformation of the DNA.

Base Sequence↗
PubMed1993

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements.

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s-1 at 30 degrees C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the -35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.

Base Sequence↗
PubMed1993

Conformational properties of the -35 region of the trp promoter in solution: comparison of the wild-type sequence with an AT transversion.

The majority of the 1H NMR resonances of the protons in a tetradecamer containing the -35 region of the trp promoter d(GCTGTTGACAATTA): d(TAATTGTCAACAGC) and in the TA transversion have been assigned. The conformational properties of the nucleotides have been determined and compared in the two duplexes. Analysis of spin-spin coupling and NOEs shows that all sugar puckers are in the south domain (i.e. near C2' endo) and the glycosidic torsion angles are anti (chi approximately 110 degrees). The NMR data are consistent with the duplex being in the B family of conformations. Significant differences in chemical shifts between the two molecules were observed only for nearest neighbours to the transversion site, suggesting the absence of long range conformational effects. This was confirmed by the similarity of coupling constants and NOEs. Other properties are also not greatly affected at positions more than two base pairs from the mutation site. These results are consistent with the hypothesis that unconstrained oligonucleotides are highly flexible, and can readily accommodate significant perturbations of the local structure, such as a transversion.

Adenine↗
PubMed1992

Very stable mismatch duplexes: structural and thermodynamic studies on tandem G.A mismatches in DNA.

We have used ultraviolet melting techniques to compare the stability of several DNA duplexes containing tandem G.A mismatches to similar duplexes containing tandem A.G, I.A, and T.A base pairs. We have found that tandem G.A mismatches in 5'-Y-G-A-R-3' duplexes are more stable than their I.A counterparts and that they are sometimes more stable than tandem 5'-Y-T-A-R-3' sequences. This is not the case for tandem G.A mismatches in other base stacking environments, and it suggests that tandem G.A mismatches in 5'-Y-G-A-R-3' sequences have a unique configuration. In contrast to tandem 5'-G-A-3' mismatches, tandem 5'-A-G-3' mismatches were found to be unstable in all cases examined.

Adenine↗
PubMed1992

Identification of glycerophosphorylcholine in mussel ovarian extracts by two-dimensional nuclear magnetic resonance.

The abundance of the "phosphodiester" peak in differentiating or proliferating tissues, including reproductive organs and tumors, warrants further investigations of its metabolic role(s), which would require a rigorous confirmation of its identity. The assignment of this peak to glycerophosphorylcholine in 31P NMR spectra of biological samples has been largely based on chemical shift, which can result in ambiguities. We employed a combination of two-dimensional 31P-1H heteronuclear shift correlation and 1H total correlation spectroscopies to trace the spin connectivities of glycerophosphorylcholine and thus to identify its structure directly from crude ovarian extracts of mussels without ambiguities and the need for extensive purification. This approach can be applied generally to the identification of molecules containing heteroatoms in crude tissue extracts.

Animals↗
PubMed1992

Conformational properties of the G.G mismatch in d(CGCGAATTGGCG)2 determined by NMR.

The conformational properties of the DNA duplex d(CGCGAATTGGCG)2, which contains two noncomplementary G.G base pairs, have been examined in aqueous solution by 1H and 31P NMR as a function of temperature. The G.G mismatch is highly destabilizing, with a Tm value 35 K below that observed for the native EcoRI dodecamer. The dodecamer appears symmetric in the NMR spectra and exists largely as an average B-type DNA conformation. However, the 1H and 31P NMR spectra give evidence of considerable conformational heterogeneity at the mismatched nucleotides and their nearest neighbors, which increases with increasing temperature. There is no evidence for a significant population of the syn purine conformation. The imino protons of the mispaired bases G4 and G9 are degenerate, resonate at high field, and exchange readily with solvent. These results indicate that the mispaired bases are only weakly hydrogen-bonded and are only partially stacked into the helix. On raising the temperature, the duplex shows increasing exchange between two or more conformations originating from the mismatch sites. However, these additional conformations maintain their Watson-Crick hydrogen bonding. The increase in chemical exchange is consistent with a quasimelting process for which the G.G sites provide local nuclei. Extensive modeling studies by dynamic annealing have confirmed that the G(anti).G(anti) conformation is favored and that the mispairs are poorly stacked within the helix. The results explain both the poor thermal stability and low hypochromicity of this duplex.

Base Sequence↗
PubMed1992

Temperature dependence of arginine kinase reaction in the tail muscle of live Sycionia ingentis as measured in vivo by 31P-NMR driven saturation transfer.

We have employed the driven 31P-NMR saturation transfer method to measure in vivo the temperature dependence of the forward and reverse unidirectional fluxes of the arginine kinase reaction in the tail muscle of a live shrimp, Sycionia ingentis. Our results indicated that neither the forward nor the reverse rate constants of this reaction were significantly temperature-dependent between 8 and 16 degrees C, in contrast to the kinetic characteristics of isolated arginine kinases.

Adenosine Triphosphate↗
PubMed1992

Effects of calcium binding on the internal dynamic properties of bovine brain calmodulin, studied by NMR and optical spectroscopy.

The dynamic properties of bovine brain calmodulin have been studied as a function of binding calcium ions, using a number of complementary spectroscopic methods. Rotational correlation times for proton-proton vectors within tyrosine and phenylalanine residues of calmodulin have been determined from time-dependent NOE measurements. In the presence of Ca2+, a range of rotational correlation times is observed. The longest value is consistent with Ca4-calmodulin having a markedly nonspherical shape in solution. In the absence of Ca2+, the rotational correlation times of all vectors are significantly shorter, indicating that several phenylalanine side chains in apocalmodulin have increased internal dynamics. Time-resolved tyrosine fluorescence anisotropy shows global correlation times broadly in agreement with the NMR results, but with an additional faster correlation time [approximately 600 ps]. Tyrosine residues in apocalmodulin have substantial segmental motion, which becomes significantly reduced, but not eliminated, when Ca2+ is bound. The correlation time for global rotation of Ca4-calmodulin increases from pH 7 to 4.5, indicating increased overall molecular asymmetry. This occurs without a significant change in total alpha-helix content as measured by circular dichroism. These results are consistent with the central region of Ca4-calmodulin being relatively flexible in solution at pH 7, but with the molecule adopting a more extended shape under more acidic conditions. The Ca(2+)-induced change in alpha-helix content can be mimicked by protonation. The alpha-helix content of Ca4-calmodulin in solution appears less than in the crystal structure; additional alpha-helix is induced in partially nonaqueous solutions, particularly at acidic pH, as used in crystallization conditions.

Animals↗
PubMed1992

Sequence-specific NMR assignments of the trp repressor from Escherichia coli using three-dimensional 15N/1H heteronuclear techniques.

Sequence-specific 15N and 1H assignments for the trp holorepressor from Escherichia coli are reported. The trp repressor consists of two identical 107-residue subunits which are highly helical in the crystal state [Schevitz, R., Otwinowski, Z., Joachimiak, A., Lawson, C. L. & Sigler, P. B. (1985) Nature 317, 782-786]. The high helical content and the relatively large size of the protein (Mr = 25,000) make it difficult to assign even the main-chain resonances by conventional homonuclear two-dimensional NMR methods. However, we have now assigned the main-chain resonances of 94% of the residues by using three-dimensional 15N/1H heteronuclear experiments on a sample of protein uniformly labelled with 15N. The additional resolution obtained by spreading out the signals into three dimensions proved indispensable in making these assignments. In particular, we have been able to resolve signals from residues in the N-terminal region of the A helix for the first time in solution. The observed NOE results confirm that the repressor is highly helical in solution, and contains no extended chain conformations.

Amino Acid Sequence↗
PubMed1992

31P NMR investigation of the backbone conformation and dynamics of the hexamer duplex d(5'-GCATGC)2 in its complex with the antibiotic nogalamycin.

Heteronuclear chemical shift correlation experiments confirm that the two down-field shifted 31P resonances in the spectrum of the (nogalamycin)2-d(GCATGC)2 complex correspond to the phosphodiesters CpA and TpG at the intercalation sites. 31P relaxation measurements (R1, R2 and [1H]-31P NOE) at 4.7 and 9.4 T permit the correlation time of each phosphate to be determined together with their chemical shift anisotropies. Significant differences in deoxyribose H3'-31P coupling constants and chemical shift anisotropy contributions are observed, consistent with an asymmetric DNA backbone conformation for the phosphate groups at the intercalation sites. Large amplitude internal motions of the phosphates do not appear to contribute significantly to relaxation.

DNA↗
PubMed1992

Hypoxia does not affect rate of ATP synthesis and energy metabolism in rice shoot tips as measured by 31P NMR in vivo.

The cytoplasmic pH, concentrations of phosphate metabolites, and rate of ATP synthesis were measured in vivo in excised rice shoot tips under normoxic and hypoxic conditions using 31P NMR. When supplied with glucose, the shoot tips grew rapidly and were relatively unaffected by hypoxia. The cytoplasmic pH decreased transiently by only 0.2 units during hypoxia, and the concentration of ATP was maintained to at least 90% of the normoxic level. Most importantly, the unidirectional rate constant of ATP synthesis from free phosphate decreased less than 25% during hypoxia. This is in contrast to other actively growing tissues such as the maize root tip. gamma-Aminobutyrate was the major nonvolatile fermentation end product after 22 h of hypoxia. Other hypoxia-induced changes included a modest increase in [Ala] and [succinate] as well as a substantial decrease in [malate].

Adenosine Triphosphate↗