PubMed Health⌕ Search

Biomedical subjects

A N Lane

Publications and source records attributed to A N Lane.

At least 73 records · Page 4Linked to original sources
PubMed1991

Solution conformation and dynamics of the octadeoxy-nucleotide d(CACTAGTG)2: a multinuclear n.m.r. relaxation study.

The conformation and internal dynamics of the octadeoxynucleotide d(CACTAGTG)2 have been examined by 1H- and 13C-n.m.r. relaxation. All the non-exchangeable protons, the seven phosphate resonances, and most of the 13C resonances of the proton-bearing carbons have been assigned by conventional two-dimensional n.m.r. methods. The average conformations of each nucleotide have been determined using time-dependent one-dimensional n.O.e.'s and 3JHH values derived from both NOESY and 2-quantum-filtered COSY experiments. All glycosidic torsion angles are anti, and in the range -95 to 125 degrees, in which the pyrimidines have a significantly larger angle than the purines. All sugars were found mainly (greater than 80%) in the conformation range C-2'endo to C-3'exo. The DNA fragment is within the B-family of conformations. The cytosine H-6-H-5 vectors move with an apparent correlation time of 3 ns at 25 degrees. Cross-relaxation rate constants for the H-1'-H-2b vectors and some H-2a-H-2b and H-2a-H-3' vectors were measured, from which order parameters were determined. The order parameters are all in the range 0.7-0.9, which is consistent with only moderate internal mobility on the sub-ns time scale. The (1H)-13C n.O.e. and the spin-lattice relaxation rate constant show that the terminal residues are relatively more mobile than the internal residues, and that the C-2'-H and C-3'-H vectors move with order parameters of 0.6-0.75.

Base Sequence↗
PubMed1991

Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation.

The antirepressor indole 3-propanoate has been shown by X-ray crystallography to bind in a different orientation compared with the natural corepressor for the tryp repressor, L-tryptophan (Lawson, C.L. & Sigler, P. B. (1988) Nature 333, 869-871). This suggests a simple difference between what constitutes a corepressor versus an antirepressor. We have used visible absorption and 1H-NMR spectroscopy to characterise the nature of several ligand-repressor complexes and DNA-binding assays to assess the relative operator binding affinities. 5-Fluorotryptophan binds with similar affinity and in the same orientation as L-tryptophan, and is an equally effective corepressor. In contrast, the tight-binding antirepressor indole 3-acrylate binds in the same orientation as indole 3-propanoate. Indole, also an antirepressor, also binds in the indole-3-propanoate orientation. 5-Methyltryptamine, a corepressor, shows spectroscopic characteristics of both tryptophan and indoleacrylate, though NOEs indicate that the tryptophan orientation is preferred. These results indicate that the ammonium group in the side chain is essential both for activation and binding in the L-tryptophan orientation. Antirepressors, lacking the ammonium group, bind in the more favourable indole-3-propanoate orientation. Differences in the NMR signatures of the different repressor-ligand complexes indicate that the details of the conformations depend on the nature of the ligands and their orientation within the binding site. Despite any conformational rearrangement of the protein on binding, dissociation of ligands is facile: 5-fluorotryptophan dissociates rapidly at 313 K. These findings complement and extend the X-ray and thermodynamic analyses of ligand binding.

Bacterial Proteins↗
PubMed1991

N.m.r. determination of the solution conformation and dynamics of the A.G mismatch in the d(CGCAAATTGGCG)2 dodecamer.

A.G base-paired mismatches that occur during replication are among the most difficult to detect by repair enzymes. Such purine.purine mispairs can exist in two conformations, one of which is stabilized by protons [Gao & Patel (1988) J. Am. Chem. Soc. 110, 5178-5182]. We have undertaken a 1H-n.m.r. and 31P-n.m.r. study of the mismatched dodecamer d(CGCAAATTGGCG)2 as a function of both temperature and pH to determine the conformational features of the A.G mismatch. At pH greater than 7 the mispaired bases are each in the anti conformation and are stacked in the B-like helix. As the pH is decreased, a second conformation becomes populated (apparent pKa approx. 5.9) with concomitant changes in the chemical shifts of protons of the mispaired bases and their nearest neighbours. Data from two-dimensional nuclear-Overhauser-enhancement spectroscopy show unequivocally that, at low pH, the dominant conformation is one in which the mismatched G residues are in the syn conformation and are hydrogen-bonded to the A residues that remain in the anti conformation. Residues not adjacent to the A.G sites are almost unaffected by the transition or the mispairing, suggesting considerable local flexibility of the unconstrained duplexes. Despite the bulging of the mispaired bases, the conformation of the A(anti).G(anti) duplex is very similar to the native dodecamer, whereas the AH+(anti).G(syn) duplex shows a greater variation in the backbone conformation at the mismatched site. According to the chemical shifts, the duplex retains twofold symmetry in solution. The equilibrium between the syn and anti conformations of G9/G21 is strongly dependent on pH, but only weakly dependent on temperature (delta H approx. 16 kJ.mol-1). The first-order rate constant for the transition is approx. 9 s-1 at 283 K and approx. 60 s-1 at 298 K, with an activation enthalpy of approx. 100 kJ.mol-1. The stabilization of the A(anti).G(syn) conformation by protons is consistent with models invoking N1 protonation of adenine. Using the derived glycosidic torsion angles we have used restrained molecular dynamics to build models of the neutral and protonated d(CGCAAATTGGCG)2 oligomers. The results confirm that the A(anti).G(anti) and AH+(anti).G(syn) conformations are favoured at high pH and low pH respectively, in accord with n.m.r. and single-crystal X-ray data.

Base Sequence↗
PubMed1991

Interaction of berenil with the EcoRI dodecamer d(CGCGAATTCGCG)2 in solution studied by NMR.

The conformation of the EcoRI dodecamer d(CGCGAATTCGCG)2 has been examined in solution by 1H and 31P NMR. Spin-spin coupling constants and nuclear Overhauser (NOE) enhancement spectroscopy show that all deoxyriboses lie in the south domain, with a small admixture of the north conformation (0-20%). The time dependence of the nuclear Overhauser enhancements also reveals a relatively uniform conformation at the glycosidic bonds (average angle, chi = -114 degrees). The average helical twist is 36.5 degrees (9.8 base pairs per turn). Tilt angles are small (in the range 0 to -10 degrees), and roll angles are poorly determined. Unlike single-crystal X-ray studies of the same sequence, there is no evidence for asymmetry in the structure. Both the NOE intensities and 31P relaxation data imply conformational anomalies at the C3-G4/C9-G10 and the A5-A6/T7-T8 steps. Berenil binds in 1:1 stoichiometry to the dodecamer with high affinity (Kd = 1 microM at 298 K) and causes substantial changes in chemical shifts of the sugar protons of nucleotides Ado 5-Cyt 9 and of the H2 resonances of the two Ado residues. No significant asymmetry appears to be induced in the DNA conformation on binding, and there is no evidence for intercalation, although the binding site is not centrosymmetric. NOEs are observed between the aromatic protons of berenil and the H1' of both Thy 7 and Thy 8, as well as to Ado 5 and Ado 6 H2. These results firmly establish that berenil binds via the minor groove and closely approaches the nucleotides Ado 6, Thy 7, and Thy 8. On the basis of quantitative NOE spectroscopy and measurements of spin-spin coupling constants, changes in the conformations of the nucleotides are found to be small. Using the observed NOEs between the ligand and the DNA together with the derived glycosidic torsion angles, we have built models that satisfy all of the available solution data. The berenil molecule binds at the 5'-AAT (identical to 5'-ATT on the complementary strand) site such that (i) favorable hydrogen bonds are formed between the charged amidinium groups and the N3 atoms of Ado 6 and Ado 18 and (ii) the ligand is closely isohelical with the floor of the minor groove.

Base Sequence↗
PubMed1991

Reciprocal communication between the lyase and synthase active sites of the tryptophan synthase bienzyme complex.

It is important to understand how the cleavage of indoleglycerol phosphate, which is catalyzed by the alpha subunits in the alpha 2 beta 2 bienzyme complex of tryptophan synthase, is modulated by the presence of L-serine in the beta subunits. Steady-state kinetic data, including the dependence of kcat on pH, allowed values to be assigned to each of the eight rate constants of the minimal catalytic mechanism. An ionizing group having an apparent pK value near 7.5 must be protonated for activity. The alpha active site ligands indolepropanol phosphate, glyceraldehyde 3-phosphate, and glycerol 3-phosphate increase both the affinity and the molar absorbance of L-serine and L-tryptophan bound to the beta active site. These effects prove that the alpha sites communicate with the beta sites over a distance of 30 A. 6-Nitroindole readily condenses with glyceraldehyde 3-phosphate, but not with L-serine. The turnover numbers for 6-nitroindoleglycerol phosphate and 6-nitroindole increased about 10-fold in both directions in the presence of L-serine bound to the beta 2 subunits. These data prove that the alpha and beta active sites communicate reciprocally and explain why the turnover number for the physiological reaction of indoleglycerol phosphate with L-serine greatly exceeds that of the cleavage reaction of indoleglycerol phosphate.

Binding Sites↗
PubMed1991

Mechanism of the physiological reaction catalyzed by tryptophan synthase from Escherichia coli.

The physiological synthesis of L-tryptophan from indoleglycerol phosphate and L-serine catalyzed by the alpha 2 beta 2 bienzyme complex of tryptophan synthase requires spatial and dynamic cooperation between the two distant alpha and beta active sites. The carbanion of the adduct of L-tryptophan to pyridoxal phosphate accumulated during the steady state of the catalyzed reaction. Moreover, it was formed transiently and without a lag in single turnovers, and glyceraldehyde 3-phosphate was released only after formation of the carbanion. These and further data prove first that the affinity for indoleglycerol phosphate and its cleavage to indole in the alpha subunit are enhanced substantially by aminoacrylate bound to the beta subunit. This indirect activation explains why the turnover number of the physiological reaction is larger than that of the indoleglycerol phosphate cleavage reaction. Second, reprotonation of nascent tryptophan carbanion is rate limiting for overall tryptophan synthesis. Third, most of the indole generated in the active site of the alpha subunit is transferred directly to the active site of the beta subunit and only insignificant amounts pass through the solvent. Comparison of the single turnover rate constants with the known elementary rate constants of the partial reactions catalyzed by the alpha and beta active sites suggests that the cleavage reaction rather than the transfer of indole or its condensation with aminoacrylate is rate limiting for the formation of nascent tryptophan.

Binding Sites↗
PubMed1991

The solution conformations of a mutant trp operator determined by n.m.r. spectroscopy.

The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation times of 50, 100, 200, 300 and 500 ms to generate sufficient NOE information to determine the individual nucleotide conformations, and place limits on the local helical parameters, using multi-spin least-squares fitting and searching in conformation space with the program NUCFIT [Lane (1990) Biochim. Biophys. Acta 1049, 189-204]. The conformations of the nucleotides are well determined, and show significant sequence-dependent variation. Pyrimidine residues on average have a wider range of sugar conformations and smaller glycosidic torsion angles than purine residues. The helical parameters are in general less well determined, though clear evidence was obtained for sequence-dependent variation of the helical twist. The overall mean fractional deviation of the calculated from the observed NOEs was 0.108. The conformations of the base-pairs TAAT are temperature-dependent [Lane (1989) Biochem. J. 259, 715-724]. NOESY spectra were recorded at 10, 25 and 40 degrees C, using mixing times inversely proportional to the overall tumbling time to allow changes in the conformation to be described. A more detailed analysis was made using one-dimensional NOEs collected for nucleotides involved in the conformational transitions. There are significant temperature-dependent changes in the conformations of the central base-pairs from T9 to T13 with the largest changes in the glycosidic torsion angle occurring for A11 and A12 (up to 30 degrees). The orientation of the base-pairs T9-A12:T10-A11 also changes, with an increase in the base-pair roll and an unwinding of the helix as the temperature is increased. The conformational changes are qualitatively similar to those observed in a related sequence (Lefèvre, Lane & Jardetzky (1988) Biochemistry 27, 1086-1094]. The conformation is also similar to the wild-type sequence and to that observed in the crystal state in the complex with the trp holorepressor. The similarity suggests that the mutation produces a poorer operator by virtue of removal of essential functional groups within the major groove.

Base Composition↗
PubMed1990

The determination of the conformational properties of nucleic acids in solution from NMR data.

A program, NUCFIT, has been written for simulating the effects of conformational averaging on nuclear Overhauser enhancement (NOE) intensities for the spin systems found in nucleic acids. Arbitrary structures can be generated, and the NOE time courses can be calculated for truncated one-dimensional NOEs, two-dimensional NOE and rotating frame NOE spectroscopy (NOESY and ROESY) experiments. Both isotropic and anisotropic molecular rotation can be treated, using Woessner's formalism (J. Chem. Phys. (1962) 37, 647-654). The effects of slow conformational averaging are simulated by taking population-weighted means of the conformations present. Rapid motions are allowed for by using order parameters which can be supplied by the user, or calculated for specific motional models using the formalism of Tropp (J. Chem. Phys. (1980) 72, 6035-6043). NOE time courses have been simulated for a wide variety of conformations and used to determine the quality of structure determinations using NMR data for nucleic acids. The program also allows grid-searching with least-squares fitting of structures to experimental data, including the effects of spin-diffusion, conformational averaging and rapid internal motions. The effects of variation of intra and internucleotide conformational parameters on NOE intensities has been systematically explored. It is found that (i) the conformation of nucleotides is well determined by realistic NOE data sets, (ii) some of the helical parameters, particularly the base pair roll, are poorly determined even for extensive, noise-free data sets, (iii) conformational averaging of the sugars by pseudorotation has at most second-order influence on the determination of other parameters and (iv) averaging about the glycosidic torsion bond also has, in most cases, an insignificant effect on the determination of the conformation of nucleotides.

Computer Simulation↗
PubMed1990

Solution conformations of d(CGTACG)2 determined from NMR experiments.

The conformations of all the nucleotides in the hexamer d(CGTACG)2 have been determined using time-dependent one- and two-dimensional nuclear Overhauser enhancements (NOEs) and the program NUCFIT (see previous article). The glycosidic torsion angles are well determined, the fraction of the C2' endo state for the sugar puckers is less well determined, and the pseudorotation phase angle is poorly determined by the NOEs. The average glycosidic torsion angle is -107 +/- 9 degrees, and the deoxyriboses of the purine residues have a higher fraction of the C2' endo state than those of the pyrimidine residues. There is good agreement between the one- and two-dimensional NOE data. Of the helical parameters, the local rise and twist are moderately well determined, but the roll and tilt of the bases are not well described. The overall structure belongs to the B family of conformations, as previously described by Gronenborn et al. (Biochem. J. (1984) 221, 723-736), but there are significant differences which can be ascribed to the improved treatment of the spin-diffusion and motional averaging possible with the program NUCFIT. The results obtained using NUCFIT are compared with those from restrained energy minimisation calculations using distance restraints obtained from NUCFIT.

Computer Simulation↗
PubMed1990

Anisotropic rotation in nucleic acid fragments: significance for determination of structures from NMR data.

Proton-proton relaxation rate constants depend on the angle between the internuclear vector and the principal axis of rotation in symmetric top molecules. It is possible to determine to rotational correlation times of the equivalent ellipsoid for DNA fragments from a knowledge of the axial ratio and the cross-relaxation rate constant for the cytosine H6-H5 vectors. The cross-relaxation rate constants for the cytosine H6-H5 vectors have been measured in the 14-base-pair sequence dGCTGTTGACAATTA.dTAATTGTCAACAGC at four temperatures. The results, along with literature data for DNA fragments ranging from 6 to 20 base pairs can be accounted for by a simple hydrodynamic equation based on the formalism of Woessner (1962). The measured cross-relaxation rate constant is independent of position in the sequence and is consistent with the absence of large amplitude internal motions on the Larmor time scale. All the data can be described by a simple hydrodynamic model, which accounts for the rotational anisotropy of the DNA fragments and allows the correlation time for end-over-end tumbling to be determined if the approximate rise per base pair is known. This is the correlation time that dominates the spectral density functions for internucleotide vectors and is significantly different from that calculated for a sphere of the same hydrodynamic volume for fragments containing more than about 14 base pairs. This method therefore allows NOE intensities used for structure calculation of nucleic acids to be treated more rigorously.

Base Sequence↗
PubMed1989

The influence of tryptophan on mobility of residues in the trp repressor of Escherichia coli.

The relative mobility of residues in the trp repressor of Escherichia coli has been examined in the absence and presence of the corepressor L-tryptophan by one- and two-dimensional 1H NMR. A comparison of relative intensities of cross peaks in NOESY and COSY spectra allowed a rigid Tyr and a mobile Tyr residue, three mobile Ser residues and three mobile Lys residues to be detected. The two Tyr residues were assigned by selective nitration with tetranitromethane. The singly nitrated molecule (on Tyr7) binds the trp operator with an affinity close to that of the unmodified repressor. Measurements of the intraring cross-relaxation rate constant as a function of temperature for Tyr7 shows the presence of considerable internal motion on the subnanosecond time scale in the flexible N-terminal arm. The order parameter, S2, characterising the motion is 0.35, which increases to about 0.5 in the presence of Trp. Trp decreases both the amplitude of the motion and the rate of the motion. At least three of the six Ser residues of the trp repressor have greater mobility than expected for a rigid body, and two of the Ser residues are sensitive to the presence of Trp. The more mobile Ser residues are probably those on the N-terminal arm and the C-terminal sequence. These results complement the single-crystal X-ray diffraction studies for which the electron density of the first ten and last three amino acid residues is weak. The solution data are consistent with proposals that the flexible N-terminal arm of the trp repressor makes important contacts with the DNA.

Bacterial Proteins↗
PubMed1989

N.m.r. assignments and temperature-dependent conformational transitions of a mutant trp operator-promoter in solution.

A total of 145 protons in the mutant trp operator-promoter sequence CGTACTGATTAATCAGTACG were assigned by one-dimensional and two-dimensional n.m.r. methods. Except at the sites of mutation (underlined), the chemical shifts and other n.m.r. parameters are very similar to those observed in the symmetrized wild-type sequence [Lefèvre, Lane & Jardetzky (1987) Biochemistry 26, 5076-5090]. Spin-spin-relaxation rate constants of the resolved base protons and intra- and inter-nucleotide nuclear-Overhauser-enhancement intensities argue for a sequence-dependent structure similar to that of the wild-type, except at and close to the sites of the mutation. The overall tumbling time as a function of temperature was determined from cross-relaxation rate constants for the H-6-H-5 vectors of the four cytosine residues. The values are consistent with the oligonucleotide maintaining a double-helical conformation over the entire temperature range 5-45 degrees C, and that internal motions of the bases are of small amplitude on the subnanosecond time scale. The temperature-dependence of chemical shifts, spin-spin-relaxation rate constants and cross-relaxation rate constants show the occurrence of two conformational transitions localized to the TTAA sequence in the centre of the molecule. The thermodynamics of the transition at the lower temperature (tm = 16 degrees C) were analysed according to a two-state process. The mid-point temperature is about 6 degrees C higher than in the wild-type sequence. The conformational transition does not lead to rupture of the Watson-Crick hydrogen bonds, but probably involves changes in the propellor twists of T.A-9 and T.A-10. The second transition occurs at about 40 degrees C, but cannot be fully characterized. This conformational variability seems to be a property of the sequence TTAA, and may have functional significance in bacterial promoters.

DNA↗
PubMed1989

Determination of internal dynamics of deoxyriboses in the DNA hexamer d(CGTACG)2 by 1H NMR.

The conformations and internal dynamics of the deoxyriboses of d(CGTACG)2 have been determined by NMR measurements at 15 degrees C. The conformations of the sugars were determined using coupling constants and time-dependent NOE measurements. The J-splitting patterns of the H1', H2' and H2" resonances show that the sugars exist as mixtures of conformations near C2' endo (south) and C3' endo (north). The population of the south conformation was larger for the purines than for the pyrimidines. The overall tumbling time of the molecule in 2H2O was determined from measurements of the cross relaxation rate constant for the H6-H5 vectors of the two cytosine residues. Order parameters were determined for the H1'-H2", H2'-H2" and H2'-H3' vectors from measurements of cross relaxation rate constants, making use of multi-spin analysis of the NOE build up rates. These order parameters are weakly dependent of the base sequence, and except for the terminal Cyt 1 residue, the H2'-H2" and H2'-H3' vectors are near unity, indicating the absence of rapid pseudorotation on the nanosecond time scale. However, the order parameter for the H1'-H2" vector is significantly smaller than expected for rapid pseudorotation indicating the presence of other motions of the sugars. This motion must be about an effective axis parallel to the H2'-H2" vector, and to occur with an angular fluctuation of about 30 degrees. The results show that to obtain highly refined structures for nucleic acids by NMR the effects of spin diffusion and motional averaging cannot be ignored.

Base Sequence↗
PubMed1988

An in vivo 1H and 31P NMR investigation of the effect of nitrate on hypoxic metabolism in maize roots.

The effect of nitrate on the short-term hypoxic response and recovery of flooded mature maize roots has been investigated in vivo by 1H and 31P NMR and in vitro by 1H NMR and gas chromatography-mass spectrometry. Employing 1H NMR in addition to 31P NMR extended the number of identifiable compounds in vivo from 4 to 15, while in vitro two-dimensional NMR and gas chromatography-mass spectrometry aided rigorous in vivo 1H NMR resonance assignments and quantitation of 24 compounds. In the absence of nitrate, the concentrations of key metabolites including alanine, ethanol, gamma-aminobutyrate, lactate, succinate, and sucrose changed during 8 h of hypoxia in a manner consistent with reduced tricarboxylic acid cycle activity and diversion to glycolytic fermentation. The pH drop in the cytoplasm during hypoxia was rapid, about 0.2 unit, and diminished quickly upon recovery. Rapid recovery of ethanol, succinate, and sucrose levels was also observed, which indicates a return to normal aerobic metabolism. Although the hypoxic response itself, including pH, was not greatly affected by the presence of nitrate, nitrate reduced the amount of fermentation end products produced, helped maintain a higher free NTP concentration during hypoxia, and increased the rate of overall recovery from hypoxia. These findings suggest the presence of a nitrate-induced maintenance-level respiration in hypoxic maize roots, which helps explain the protection imparted by nitrate to flooded hypoxic maize plants.

Energy Transfer↗
PubMed1988

Interaction of the trp repressor from Escherichia coli with a constitutive trp operator.

The interaction of the trp repressor from Escherichia coli with a 20 bp fragment of DNA (CGTACTGATT.AATCAGTACG) corresponding to a mutant trp operator was studied by c.d. in the presence and absence of the co-repressor, L-tryptophan, and as a function of the concentration of K+ and Na+ ions. The affinity of the repressor for the mutant operator in the presence of tryptophan is about three orders of magnitude lower than the wild-type sequence. Binding in the absence of tryptophan is about 100-fold weaker than to the wild-type. The dependence of the dissociation constant on the concentration of K+ or Na+ is weak [d(log Ks)/d(log[M+]) = 2.5], and independent of the cation, indicating that electrostatic interactions are not as important for this repressor as for others.

Bacterial Proteins↗
PubMed1988

A description of conformational transitions in the Pribnow box of the trp promoter of Escherichia coli.

Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature. The changes were localized to the sequence TTAA in the Pribnow box (underlined). Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations. The midpoints of the first and second transitions were 9 and 30 degrees C, with enthalpy changes of 58 and 35 kcal/mol, respectively. Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions. The line width of the H2 of A11 goes through a maximum at about 30 degrees C, indicating moderately fast exchange between the states. The rate constants for exchange at the midpoints were about 200 (I----II) and 250 (II----III) s-1. Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter. This mechanism can explain the temperature dependence observed for the initiation of transcription.

Base Sequence↗
PubMed1987

Solution structure of the Trp operator of Escherichia coli determined by NMR.

We have assigned the majority of the nonexchangeable protons in the NMR spectrum of the 20 base-pair fragment of DNA corresponding to the Trp operator of Escherichia coli. The sequence (CGTACTAGTTAACTAGTACG) also contains a Pribnow box (underlined). Variation of the intrinsic spin-lattice relaxation rate constants of the H8's along the sequence indicates that the structure of the oligonucleotide is not regular. Splitting patterns of the H1' resonances in the deoxyriboses, obtained from a two-dimensional J-resolved experiment, allowed the dominant pucker mode of each nucleotide to be determined. Intranucleotide NOEs from the sugar protons H1', H2', and H3' to the base protons were used to determine the conformation of each nucleotide (puckers and glycosidic torsion angles). The relative orientations of nucleotide units (roll, propeller twist, helical twist angle, and pitch) were calculated by using internucleotide NOEs between protons of neighboring nucleotides in the sequence. All these parameters were determined for each step along the 20-mer. The structure belongs to the B family of conformations, but variations of the local geometry are observed from step to step. Some of the variations, such as the roll and the twist angles, can be predicted by the rules of Calladine and Dickerson [Calladine, C. R., & Dickerson, R. E. (1983) J. Mol. Biol. 166, 419-441]. The puckers of the deoxyriboses of purines are found mainly in conformations near C2' endo, while those of the pyrimidines prefer C3' endo and related conformations. Glycosidic torsion angles obtained for purines are larger than those of pyrimidines. Except for this last observation, the general properties of the operator DNA structure are comparable with those of crystal structures of B DNA of other sequences.

Base Sequence↗