Biomedical subjects
Publications and source records attributed to D V Goeddel.
A recombinant lambda bacteriophage isolated from a human genome library contains the gene for fibroblast interferon (IFN-beta1). The DNA sequence of this gene is identical to the sequence of its mRNA and is devoid of introns.
Eight classes of human leukocyte interferon (LeIFN) cDNA clones have been identified in a cDNA library prepared from a myeloblastoid cell line. The nucleotide sequences demonstrate that the multiple human LeIFN genes code for a family of homologous, yet distinct proteins. One of the cDNA clones may have been derived from the transcription of a LeIFN pseudogene.
A novel human leukocyte interferon cDNA clone (LeIF B) was identified in a cDNA library prepared using polyadenylated mRNA of a myeloblastoid cell line. The nucleotide sequence of LeIF B differs significantly from other published leukocyte interferon cDNA sequences. An expression plasmid was constructed which directs the synthesis in E. coli of 8 x 10(7) interferon units per liter of culture. LeIF B exhibits markedly different specificities from another bacterially synthesized human leukocyte interferon, LeIF A.
Explore the source record for details and available documents.
A gene has been constructed which codes for an analog of human proinsulin in which the normal 35-amino acid connecting peptide is replaced by a "mini-C" peptide of six amino acids (Arg-Arg-Gly-Ser-Lys-Arg). The gene, composed of oligonucleotide fragments synthesized by the triester method, was cloned and expressed as a beta-galactosidase hybrid protein. The proinsulin analog was separated from beta-galactosidase by cyanogen bromide cleavage and purified. Controlled disulfide exchange in the S-sulfonate of the analog generated a molecule having high-pressure liquid chromatography (HPLC) and radioimmunoassay (RIA) behavior consistent with a proinsulin-like structure.
At least eight leukocyte interferon genes (IFL) and the single fibroblast interferon gene (IFF) have been located on chromosome 9 in humans. In somatic cell hybrids of human and mouse cells containing a normal complement of mouse parental cell chromosomes but reduced numbers of human chromosomes, the human leukocyte and fibroblast interferon DNA sequences were present only when human chromosome 9 was also present.
The gene for human leukocyte interferon alpha 2 (designated either LeIF A or HuIFN-alpha 2) has been isolated from a human genome library. The DNA sequence of this gene demonstrates that it lacks introns. The 3' noncoding sequences of the IFN-alpha 2 gene correspond to two types of IFN-alpha 2 cDNA clones we have isolated that have alternate sites of polyadenylylation. A comparison of seven human IFN-alpha sequences shows that they are homologous in the 5' flanking region and contain identical "TATA box" sequences. The recombinant lambda clone containing the IFN-alpha 2 gene also contains two copies of the "Alu family" repeat sequence.
Thymosin alpha 1, an immune restorative polypeptide hormone, was synthesized in Escherichia coli by using recombinant DNA cloning techniques. Based on the known amino acid sequence, a gene coding for the thymosin alpha 1 polypeptide chain was designed and enzymatically assembled from chemically synthesized oligodeoxyribonucleotide fragments. The gene was ligated into plasmid pBR322 and placed under lac operon control, and N alpha-desacetylthymosin alpha 1 was expressed as part of a beta-galactosidase chimeric protein. Cyanogen bromide cleavage of this protein gave a mixture of polypeptides, among which thymosin alpha 1 activity was detected by radioimmunoassay (RIA). The E. coli product is identical with native thymosin alpha 1 isolated from calf thymus in the amino acid sequence but lacks the N-terminal acetyl group. Results of a guinea pig migration inhibition factor (MIF) assay, a terminal deoxyribonucleotidyl transferase (TdT) assay, and radioimmunoassay indicate that the N alpha-desacetylthymosin alpha 1 produced by deoxyribonucleic acid (DNA) cloning techniques has biological activity equivalent to that of the native hormone.
A human leukocyte interferon cDNA was enzymatically synthesized, inserted into the vector pBR322, and cloned in Escherichia coli. The DNA sequence codes for a 23-amino acid signal peptide followed by an interferon polypeptide of 165 amino acids. An expression plasmid was constructed which permits the synthesis in E. coli of 2.5 x 10(8) units of interferon per litre of culture. This LeIF protected squirrel monkeys from lethal encephalomyocarditis virus infection.
A cDNA library was constructed using mRNA from human fibroblasts induced with poly(I):poly(C). A bacterial clone containing fibroblast interferon cDNA sequences was identified by hybridization to a cDNA probe synthesized using deoxyoligonucleotide primers which hybridize to fibroblast interferon mRNA specifically. Expression plasmids were constructed which permitted the synthesis in E. coli of 8 x 10(7) units of human fibroblast interferon per liter of culture. The bacterially produced fibroblast interferon is indistinguishable from authentic human fibroblast interferon by several criteria.
Recombinant bacterial plasmids that contain DNA complementary to human preproinsulin messenger RNA have been constructed. One clone contains the entire preproinsulin coding region, as well as the 3' untranslated region of the messenger RNA and eight nucleotides of the 5' untranslated region. Additional sequence information for the 5' untranslated region was obtained with the use of insulinoma messenger RNA in conjunction with specific primers from the cloned DNA for enzymatic chain termination sequence analysis. The results confirm the amino acid sequence of human proinsulin previously determined, and predict the amino acid sequence of the human preproinsulin signal peptide.
DNA coding for human growth hormone was constructed by using chemically synthesised DNA in conjunction with enzymatically prepared cDNA. This 'hybrid' gene was expressed in Escherichia coli under the control of the lac promoter. A polypeptide was produced having the size and immunological properties characteristic of mature human growth hormone.
Explore the source record for details and available documents.
Synthetic genes for human insulin A and B chains were cloned separately in plasmid pBR322. The cloned synthetic genes were then fused to an Escherichia coli beta-galactosidase gene to provide efficient transcription and translation and a stable precursor protein. The insulin peptides were cleaved from beta-galactosidase, detected by radioimmunoassay, and purified. Complete purification of the A chain and partial purification of the B chain were achieved. These products were mixed, reduced, and reoxidized. The presence of insulin was detected by radioimmunoassay.
Explore the source record for details and available documents.
A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.
Nucleotide analogs were substituted for unmodified nucleotides at specific sites in the lac operator sequence by a combination of chemical and enzymatic procedures. The nitrocellulose filter assay was used to study the interactions of these modified operators with wild-type (SQ) and tight-binding (QX86) lac repressors. These studies implicate directly the 5 methyl of thymine and the 2 amino of guanine as important operator-repressor contact sites. Furthermore, when these findings are combined with published results from other laboratories, a model for the lac operator-lac repressor interaction can be derived. Two important postulates follow from this model. (i) The repressor interacts at specific and defined sites with the N7 of guanine, the 5 methyl of thymine, the 2 amino of guanine, and the central major groove of the operator. (ii) The repressor binds to one side of the operator.
The chemical synthesis of lactose operator DNA segments is described. The 31-base-paired duplex contains the DNA recognized by lac repressor protein and twofold rotationally symmetric base pairs on either side of the tight binding region. The synthesis includes the deoxyoligonucleotides d(T-G-T-G-G), d(A-A-T-T-G-T-G-A-G), d(C-G-G-A-T-A-A-C-A-A-T-T), d(T-C-A-C-A), d(T-G-T-G-A-A-A-T-T-G-T), d(T-A-T-C-C-G-C-T-C-A-C), and d(A-A-T-T-C-C-A-C-A). These deoxyoligonucleotides were characterized by two-dimensional sequencing techniques, paper chromatography, and thin-layer chromatography.