PubMed Health⌕ Search

Biomedical subjects

G A Maksakova

Publications and source records attributed to G A Maksakova.

At least 19 recordsLinked to original sources
PubMed2006

[An oligonucleotide microarray for detection and discrimination of orthopoxviruses based on oligonucleotide sequences of two viral genes].

An oligonucleotide microarray for detection and identification of orthopoxviruses was developed. Genus specific and orthopoxvirus species-specific regions of the genes encoding chemokine binding and alpha/beta-interferon binding proteins were used as a target. The developed microarray allows the variola, monkeypox, cowpox, vaccinia, camel-pox and ectromelia (mousepox) viruses to be distinguished with a high degree of reliability.

Gene Amplification↗
PubMed2001

Interaction of endonuclease ecoRI with short specific and nonspecific oligonucleotides.

The interaction of EcoRI with different oligodeoxyribonucleotides (ODNs) was analyzed using the method of the slow step-by-step simplification in their complexity. Orthophosphate (KI = 31 mM), 2-deoxyribose 5-phosphate (KI = 4.6 mM) and different dNMPs (KI = 2.1-2.5 mM) were shown to be the minimal ligands of the enzyme. The lengthening of a nonspecific d(pN)n (n = 1-6) by one nucleotide unit resulted in the increase of their affinity by a factor of approximately 2.0. Weak nonspecific electrostatic contacts of EcoRI with internucleotide phosphate groups of ODNs can account for about 5 orders of magnitude in the ligand affinity, whereas the contribution of specific interactions between EcoRI and d(pN)n is no more than 2 orders of magnitude of a total ODN's affinity.

Base Sequence↗
PubMed1999

Single-stranded oligodeoxyribonucleotides are substrates of Fpg protein from Escherichia coli.

The interaction of Escherichia coli Fpg protein, which catalyzes excision of several damaged purine bases including 8-oxoguanine (oxoG) from DNA with a set of single- (ss) and double-stranded (ds) 23-mer oligodeoxyribonucleotides (ODNs) containing 8-oxoguanine(s) at various positions, has been investigated. The affinities of different ss ODNs (KM = 0.55-1.3 microM) were shown to be 12-170 times less than those for corresponding ds ODNs (KM = 6-60 nM). Depending on the position of the oxoG within the ODNs, relative initial rates of conversion of ss substrates may be less than, comparable, or greater than those for ds ODNs. The enzyme can remove 5'-terminal oxoG from ODNs only if the 5'-end is phosphorylated. Fpg does not release oxoG residues from the ultimate and penultimate 3'-terminal positions. Duplexes containing two adjacent oxoG are poor substrates for the glycosylase.

DNA↗
PubMed1998

Structural constraints in the HIV-1 reverse transcriptase-primer/template complex for the initiation of DNA synthesis from primer tRNALys3.

The topography and functional implications of the complex formed in vitro between human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) and its primer tRNALys3 were studied in this work. On the basis of previous results showing the high affinity both of the native primer, tRNALys3, as well as that of mismatched short oligonucleotide primers for HIV-1 RT, we synthesized chimeric primers containing tRNALys3 linked to U and T residues of different lengths. We found that the affinity of the oligonucleotide primers for HIV-1 RT is dramatically increased when linked to primer tRNA. Our results also show that in the tRNA.RT complex, before annealing tRNALys3 to the retroviral RNA genome, the 3'-terminal nucleotide of tRNALys3 is positioned at a distance of one nucleotide unit away from the template in the active polymerization site of the enzyme.

Binding Sites↗
PubMed1998

HIV-1 reverse transcriptase is capable of elongating derivatives of sequence specific noncomplementary oligodeoxynucleotides.

We have carried out a comparison of KM and Vmax values for various primers in the polymerization reaction catalyzed by the HIV-1 RT. The affinity of RT for complementary d(pT)6 containing two different 5'-end pyranone derivatives was 2-3 orders of magnitude higher (KM = 3-15 nM) than that of d(pT)6 (KM = 12.6 mM). Oligodeoxynucleotides (ODNs) noncomplementary to poly(A) template were not elongated by RT. However, derivatives of d(CAGGTG) containing the 5'-terminal chromone and coumarin related groups were efficient primers showing KM (30-300 nM) and Vmax (75-93%) values comparable with that for d(pT)10 (800 nM; 100%). The [d(CAGGTG)]ddT ODN derivatives were effective inhibitors of RT. The primer function of derivatives of noncomplementary ODNs appears to be due to the additional interactions of their 5'-terminal groups with the enzyme tRNA-binding site.

Binding Sites↗
PubMed1997

Recognition and conversion of single- and double-stranded oligonucleotide substrates by 8-oxoguanine-DNA glycosylase from Escherichia coli.

The substrate specificity of 8-oxoguanine-DNA glycosylase was studied. The data showed for the first time that the enzyme can cleave single-stranded deoxyoligonucleotides containing an 8-oxoG link. The values of K(m) and Vmax for a range of single-stranded and double-stranded oligonucleotides (23 bp) containing 8-oxoG at different positions of one chain. These parameters consistently depended on the position of 8-oxoG in single-stranded or double-stranded substrates. A possible mechanism responsible for substrate recognition by 8-oxoguanine-DNA glycosylase is described.

Base Sequence↗
PubMed1997

[Photomodification of DNA with a perfluorylazide-derived oligonucleotide].

The kinetics of photomodification of oligodeoxyribonucleotide pd(GTGTGA) with a derivative of the complementary oligodeoxyribonucleotide pd(CACACA) bearing a 3-(n-azidotetrafluorobenzoylamino)propylamine residue (ArN3) at the terminal phosphate group was studied at 20 degrees C. It was found that the target's G3 residue is preferentially modified. Along with the transformation of the arylazide moiety, degradation of the oligonucleotide fragment of the reagent occurred with a partial loss of affinity. With the use of the reagent labeled at the 5'-end, sites of photomodification were found. From the dependence of the modification level on the reagent concentration at the initial time of irradiation, the association constant (Kx = (1.40 +/- 0.24) x 10(5) M-1) was determined. From the dependence of the modification level on the concentration of the pre-irradiated reagent, the constant of the transformed reagent-target association in solution (Kr = (2.49 +/- 0.30) x 10(4) M-1) was determined. From the time-dependence of the modification level [PZ]/P0, the rate constant for the limiting step of photomodification (k0 = (5.31 +/- 0.28) x 10(-4) S-1) and the modification efficiency of the target in the complex with the reagent (gamma = 1) were found.

Autoradiography↗
PubMed1996

The algorithm of estimation of the Km values for primers in DNA synthesis catalyzed by human DNA polymerase alpha.

DNA synthesis with various deoxyribo homo- and heterooligoprimers in the presence of complementary templates was investigated. The lengthening of d(pN)n, primers (n = 1-10) by a unit resulted in an increase of the primer affinity and a maximal rate of polymerization. The coefficient of the affinity enhancement of primers due to formation of one hydrogen bond between primer and template was found to be 1.35. The dependence of the primer affinity and polymerization rate on template-primer structure in solution was analyzed and the objective laws of the changes of the KM and Vmax values were revealed.

Algorithms↗
PubMed1995

[Kinetics of DNA photomodification by derivatives of 1-(3-(p-azidotetrafluorobenzoyl)aminopropyl)-5'-phosphamides of oligodeoxyribonucleotides in model duplexes].

Kinetics of photomodification of 26-meric deoxyribonucleotide pTTGCCTTGAATGGGAA-GAGGGTCATT with derivatives of the complementary oligonucleotides pTCTTCCCATTC, pTCTTCCCA, and pTTCCCA bearing a residue of (p-azidotetrafluorobenzoyl)aminopropylamine(-ArN3) attached to the terminal phosphate (reagents I, II, and III, respectively) was studied at 37 degrees C. It was established that during irradiation the reagents are inactivated, loosing their affinity to the target. A kinetic equation describing the modification was suggested. From the dependence of the time-limited modification level on the reagent concentration, the association constants of the reagents with the target were determined: [Kx = (9.9 +/- 0.4) x 10(4), (1.1 +/- 0.1) x 10(5), and (8.4 +/- 2.1) x 10(6) M-1 for reagents I, II, and III, respectively] and the efficiency of the modification in the complex gamma ef (ca. 0.3 for all the reagents) were determined. From the dependence of the modification level [PZ]/p0 on time for reagent II, the rate constant was determined for the rate-determining step of the photomodification k0 = (7.9 +/- 0.9) x 10(-3) s-1, which is close to the rate constant for the photolysis of p-azidotetrafluorobenzoic acid kp = (5.5 +/- 0.3) x 10(-3) s-1.

Azides↗
PubMed1992

The influence of the target structure on the efficiency of alkylation of single-stranded DNA with the reactive derivatives of antisense oligonucleotides.

Site-directed alkylation of three oligonucleotide targets: 41-mer (hairpin structure), 22-mer (loop part of this hairpin) and 10-mer (part of the loop) with 5'-p-(N-2-chloroethyl-N-methylamino)benzylamides of oligonucleotides complementary to the loop region was studied. Thermodynamic parameters of the interaction were estimated using the dependence of the limit modification extent on the reagent concentration at several temperatures. The stability of the complex increases significantly in the set: 302-mer carrying above hairpin, 41-mer, 22-mer, the data for 22-mer and 10-mer being nearly identical. This indicates significant influence of the loop supporting structure on the interaction with antisense reagents.

Alkylation↗
PubMed1992

[Structure of a single-stranded DNA target as a factor influencing the effectiveness of its modification with a complementary reagent].

Site directed alkylation of three oligonucleotide targets: 41-mer (hairpin structure), 22-mer (loop part of this hairpin) and 10-mer (part of the loop) with 5'-p-(N-2-chloroethyl-N-methylamino)benzylamides of oligonucleotides complementary to the loop region was studied. Thermodynamic parameters of the interaction were estimated using the dependence of the limit modification extent on the reagent concentration at different temperatures. The stability of the complex increases much in the set: 302-mer carrying the above hairpin, 41-mer, 22-mer; data on 22-mer and 10-mer being almost identical. This indicates significant influence of the loop supporting structure on the interaction with antisense reagents.

Alkylation↗
PubMedDate not supplied

Synthesis of azidoaniline derivatives of oligonucleotides and investigation of their photochemical behavior.

A series of aryl azides, p-N3C6H4NH(CH2)nNH2 with n = 2-6, have been synthesized and used to prepare oligonucleotide derivatives carrying photoreactive the p-azidoaniline residue. Reactive moieties have been coupled to the 5'-terminal phosphate of d(pGATACCAA) [compounds IV(b), IV(c), and IV(e) with n = 3, 4, and 6, respectively] and of d(pGCC) [compound V(b) with n = 3] via a phosphoamide bond. Irradiation at wavelengths over > 300 nm of IV(b) and V(b) (n = 3) resulted in cleavage of the P-N bond. However, under the same reaction conditions, the P-N bond remained intact for compounds containing longer spacers [IV(c) and IV(e)]. Intraduplex reaction of the latter derivatives with d(GGTATCp)NH(CH2)6NH2 resulted in cross-linking dependent on the presence of an aliphatic amino group. The results obtained have demonstrated that the azidoaniline derivatives of oligonucleotides capable of the affinity modification of a specific target can be prepared. However, the sufficiently long aliphatic spacer group is necessary to prevent P-N bond cleavage within the photoreactive oligonucleotide.

Alanine↗
PubMedDate not supplied

Formation of the D-loop structure complexes between DNA and oligonucleotides and affinity modification of DNA by chemically reactive derivatives of oligonucleotides lead to the recombination.

INTRODUCTION: Affinity modification of DNA by chemically reactive derivatives of complementary oligonucleotides (ODNs) and antisense ODNs has shown an application for the inhibition of gene expression and the growth of viruses and parasites in high organisms. Unfortunately, the rapid advancement of antisense therapeutic approaches is not parallel to the investigation of possible consequences of antisense and gene-directed ODNs on genetic material of the cells being treated. Here we tried for the first time to estimate a possible genetic impact of antisense ODNs and their chemically reactive derivatives on the cells using bacteria and the plasmid DNA. MATERIAL AND METHODS: Recombination of direct repeats, induced by the formation of reversible complexes of plasmid DNA with complementary ODNs and after covalent binding of the alkylating derivative of the ODNs with DNA, has been investigated. For this purpose, a polylinker sequence flanked by 165 bp direct repeats was inserted within the tet gene of pBR 327. This plasmid was used to construct DNA containing AT- and GC-rich sequences placed in the central region of the polylinker. RESULTS: Transformation of E. coli cells with the plasmids (and with mixtures of the plasmids with d(pN)17 complementary to the AT- and GC-rich sequences) did not produce deletions. After modification of plasmids with alkylating derivatives of d(pN)17, the deletion of the polylinker DNA region (recombination) revealed the restoration of the tet gene function. The same effect was found at the cell transformations with the D-loop complex of the plasmids with ODNs, but the frequency of the transformants was about 1.5-2 times lower. The data obtained demonstrate that the complexes of DNA with complementary ODNs and the modification of the plasmids by reactive ODN derivatives result in induction of the recombination process and in loss of genetic material.

Base Sequence↗
PubMedDate not supplied

[Quantitative characteristics of modifying nucleic acids by alkylating oligonucleotide derivatives in the presence of oligonucleotide effectors].

Modification of the 26-meric DNA fragment d(TTGCCTTGAATGGGAAGAGGGTCATT) with 4-(N-2-chloroethyl-N-methylamino)benzyl-5'-phosphamide derivative of hexadeoxyribonucleotide d(pTTCCCA) was investigated in the presence of two bis-3',5-N-(2-hydroxyethyl)phenazinium derivatives of octadeoxyribonucleotides (effectors E1 and E2) forming complementary complexes with the target next to 3'- and 5'-ends of the reagent's recognition site, respectively. In the absence of effectors, G17 is predominantly modified. Some minor modification of G12, G13 and G14 was also observed. The association constant of the target with the reagent was calculated using the dependence of the modification extent on the initial concentration of the reagent and was found to be Kx = (2.16 +/- 0.38) x 10(4) M-1 at 25 degrees C. At the reagent concentration 5 x 10(-6) M the target modification was nearly absent. In the presence of E1 the modification extent of the 26-mer increased with its concentration to a plateau value of approximately 0.5. Quantitative treatment of this concentration dependence permitted to estimate the value of the product Ke1 alpha = (3.95 +/- 0.43) x 10(8) M-1, where alpha 1 is the cooperativity coefficient and Ke1 is the association constant of the target with E1. To determine alpha 1, the Ke1 value was measured by the gel retardation method and found to be (5.06 +/- 0.23) x 10(7) M-1. Consequently, alpha 1 approximately 8. Effector E2 is less efficient and permits to reach the plateau value only as low as 0.24. This may be due to the competition of the reagent and E2 for the reagent recognition site, since the latter is partially complementary to this site. The increase of the E2 concentration results in a decrease of the modification extent of G17 accompanied with an increase of the modification extent of G12-G14. Thus, in the conditions used the oligonucleotide effectors although increasing the duplex stability do not permit to achieve quantitative yields as it should be for reactions proceeding in quasi-equilibrium conditions.

Alkylation↗