Biomedical subjects

G E Muscat

Publications and source records attributed to G E Muscat.

At least 37 records · Page 2Linked to original sources

PubMed1998

The corepressor N-CoR and its variants RIP13a and RIP13Delta1 directly interact with the basal transcription factors TFIIB, TAFII32 and TAFII70.

Repression of transcription by the classical nuclear receptors (e.g. TR, RAR), the orphan nuclear receptors (e.g. Rev-erbAalpha/beta), Mxi-1 and Mad bHLH-zip proteins and the oncoproteins PLZF and LAZ3/BCL6 is mediated by the corepressors N-CoR and SMRT. The interaction of the corepressors with the components involved in chromatin remodelling, such as the recruiting proteins Sin3A/B and the histone deacteylases HDAc-1 and RPD3, has been analysed in detail. The N-CoR/Sin3/HDAc complexes have a key role in the regulation of cellular proliferation and differentiation. However, the interaction of these corepressors with the basal transcriptional machinery has remained obscure. In this study we demonstrated that the N-terminalrepression domains and the receptor interactiondomains (RID) of N-CoR and its splice variants, RIP13a and RIP13Delta1, directly interact with TAFII32 in vivo and in vitro . We show that interaction domain II within the N-CoR and RIP13a RID is required for the interaction with TAFII32. We also observed that N-CoR directly interacts with each of the basal factors, TFIIB and TAFII70, and can simultaneously interact with all three basal factors in a non-competitive manner. Furthermore, we provide evidence that suggests the RVR/Rev-erbbeta-corepressor complex also interacts with the general transcriptional machinery, and that the physicalassociation of TFIIB with N-CoR also occurs in the presence of Sin3B and HDAc-1. Interestingly, we observed that N-CoR expression ablated the functional interaction between TFIIB and TAFII32 that is critical to the initiation of transcription. In conclusion, this study demonstrates that the N-terminal repressor region and the C-terminal RIDs are part of the corepressor contact interface that mediates the interaction with the general transcription factors, and demonstrates that TAFs can also directly interact with corepressors to mediate signals from repressors to the basal machinery. We also suggest that N-CoR interacts with the central components of the transcriptional initiation process (TFIIB, TAFs) and locks them into a non-functional complex or conformation that is not conducive to transcription.

Animals↗

PubMed1998

Identification and characterization of a novel corepressor interaction region in RVR and Rev-erbA alpha.

Rev-erbA alpha and RVR are orphan nuclear receptors that function as dominant transcriptional silencers. Ligand-independent repression of transcription by Rev-erbA alpha and RVR is mediated by the nuclear receptor corepressors, N-CoR and its variants RIP (RXR interacting protein) 13a and RIP13 delta 1. The physical association between the corepressors and Rev-erbA alpha and RVR is dependent on the presence of a receptor interaction domain (RID) in the N-CoR family. Our previous study demonstrated that the E region of RVR and Rev-erbA alpha is necessary and sufficient for the in vivo interaction with the nuclear receptor corepressor, RIP13 delta 1. The present investigation demonstrates that two corepressor interaction regions, CIR-1 and CIR-2, separated by approximately 150 amino acids in the E region of RVR, are required for the interaction with N-CoR, RIP13a, and RIP13 delta A. The D region is not required for the physical interaction. In contrast, the D and E regions of Rev-erbA alpha were necessary for the interaction with the N-CoR and RIP13a-RIDs in vivo, suggesting that RIP13 delta 1 and N-CoR/RIP13a differentially interact with Rev-erbA alpha. Mutagenesis of CIR-1, a novel domain that is highly conserved between RVR and Rev-erbA alpha, demonstrated that the N-terminal portion of helix 3 plays a key role and is absolutely necessary for the interaction with RIP13 delta 1, RIP13a, and N-CoR. The phenylalanine residues, F402 and F441, in RVR and Rev-erbA alpha, respectively, were critical residues in supporting corepressor interaction. Cotransfection studies demonstrated that repression of a physiological target, the human Rev-erbA alpha promoter, by RVR was significantly impaired by mutation of CIR-1 or deletion of CIR-2. Furthermore, overexpression of either the N-CoR/RIP13a or RIP13 delta 1-RIDs alleviated RVR-mediated repression of the Rev-erbA alpha promoter, demonstrating that corepressor binding mediates the repression of a native target gene by RVR. A minimal region containing juxtapositioned CIR-1 and CIR-2 was sufficient for corepressor binding and transcriptional repression. In conclusion, our study has identified a new corepressor interaction region, CIR-1, in the N terminus of helix 3 in the E region of RVR and Rev-erbA alpha, that is required for transcriptional silencing. Furthermore, we provide evidence that CIR-1 and CIR-2 may form a single corepressor interaction interface.

Amino Acid Sequence↗

PubMed1998

Repression of basal transcription by vitamin D receptor: evidence for interaction of unliganded vitamin D receptor with two receptor interaction domains in RIP13delta1.

Repression of basal transcription of a 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3) responsive 25-hydroxyvitamin D3-24-hydroxylase (CYP24) promoter construct as observed in kidney cells in the absence of ligand and this repression was dependent on a functional vitamin D response element (VDRE). Basal repression was also seen with a construct where a consensus DR-3-type VDRE was fused to the thymidine kinase promoter. Expression of a dominant negative vitamin D receptor (VDR) isoform that strongly bound to the VDRE motif in the CYP24 promoter ablated basal repression. This VDR isoform lacked sequence in the hinge- and ligand-binding domains implicating one or both of these domains in basal repression. It is well known that thyroid hormone and retinoic acid receptors silence basal transcription of target genes in the absence of ligands and this repressor function can be mediated by the nuclear receptor corepressor N-CoR. Two variants of N-CoR have been described, RIP13a and RIP13delta1. N-CoR and the variants contain two receptor interaction domains, ID-I and ID-II, which are identical except region ID-II in RIP13delta1 has an internal deletion. We have used the mammalian two hybrid system to investigate whether VDR, in the absence of ligand 1,25-(OH)2D3, can interact with these domains. The data showed that unliganded VDR does not interact with either ID-I or ID-II from RIP13a and RIP13delta1, but does interact strongly with a composite domain of ID-I and ID-II from RIP13delta1 (but not from RIP13a) and this strong interaction is abrogated in the presence of ligand. This finding implicates RIP13delta1 in VDR-dependent basal repression of the promoter constructs under investigation. However, over-expression of RIP13delta1 in kidney cell lines did not alter basal expression of the CYP24 promoter construct. It is concluded that either the level of endogenous RIP13delta1 in these kidney cells permits maximal repression or that repression occurs by a mechanism that is independent of RIP13delta1. Alternatively, repression may be dependent on RIP13delta1 but requires an additional cofactor that is limiting in these cells.

Animals↗

PubMed1997

SOX9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouse.

Two lines of evidence suggest that the Sry-related gene Sox9 is important for chondrogenesis in mammalian embryos. Sox9 mRNA is expressed in chondrogenic condensations in mice, and mutations in human SOX9 are known to cause skeletal dysplasia. We show here that mouse SOX9 protein is able to bind to a SOX/SRY consensus motif in DNA and contains a modular transcriptional activation domain, consistent with a role for SOX9 as a transcription factor acting on genes involved in cartilage development. One such gene is Col2a1, which encodes type II collagen, the major structural component of cartilage. We have compared, in detail, the expression of Sox9 and Col2a1 during mouse development. In chondrogenic tissues the expression profiles of the two genes were remarkably similar. Coexpression was detected in some nonchondrogenic tissues such as the notochord, otic vesicle, and neural tube, but others such as heart and lung differed in their expression of the two genes. Immunohistochemistry using an antibody specific for SOX9 revealed that expression of SOX9 protein mirrored the distribution of Sox9 mRNA. Our results suggest that SOX9 protein is involved in the regulation of Col2a1 during chondrogenesis, but that this regulation is likely to depend on additional cofactors.

Animals↗

PubMed1996

Two receptor interaction domains in the corepressor, N-CoR/RIP13, are required for an efficient interaction with Rev-erbA alpha and RVR: physical association is dependent on the E region of the orphan receptors.

Rev-erbA alpha and RVR/Rev-erb beta/BD73 are orphan steroid receptors that have no known ligands in the 'classical sense'. These 'orphans' do not activate transcription, but function as dominant transcriptional silencers. The thyroid hormone receptor (TR) and the retinoic acid receptor (RAR) act as transcriptional silencers by binding corepressors (e.g. N-CoR/RIP13 and SMRT/TRAC-2) in the absence of ligands. The molecular basis of repression by orphan receptors, however, remains obscure, and it is unclear whether these corepressors mediate transcriptional silencing by Rev-erbA alpha and RVR. Recently, two new variants of N-CoR have been described, RIP13a and RIP13delta1. The characterisation of these splice variants has identified a second receptor interaction domain (ID-II), in addition to the previously characterised interaction domain (ID-I). This investigation utilised the mammalian two hybrid system and transfection analysis to demonstrate that Rev-erbA alpha and RVR will not efficiently interact with either ID-I or ID-II separately from RIP13a or RIP13delta1. However, they interact efficiently with a domain composed of ID-I and ID-II from RIP13a. Interestingly, the interaction of Rev-erbA alpha and RVR is strongest with ID-I and ID-II from RIP13delta1. Detailed deletion analysis of the orphan receptor interaction with RIP13/N-CoR rigorously demonstrated that the physical association was critically dependent on an intact E region of Rev-erbA alpha and RVR. Over-expression of the corepressor interaction domains (i.e. dominant negative forms of N-CoR/RIP13) could alleviate orphan receptor-mediated repression of transactivation by GALVP16. This demonstrated that these regions could function as anti-repressors. In conclusion, these data from two independent approaches demonstrate that repression by Rev-erbA alpha and RVR is mediated by an interaction of ID-I and ID-II of N-CoR, RIP13a and delta1 with the putative ligand binding domain of the orphan receptors.

DNA-Binding Proteins↗

PubMed1996

Transcriptional repression by the orphan steroid receptor RVR/Rev-erb beta is dependent on the signature motif and helix 5 in the E region: functional evidence for a biological role of RVR in myogenesis.

RVR/Rev-erb beta/BD73 is an orphan steroid receptor that has no known ligand in the "classical' sense. RVR binds as a monomer to an element which consists of an A/T-rich sequence upstream of the consensus hexameric half-site. However, RVR does not activate transcription and blocks transactivation of this element by ROR/RZR. The mechanism of RVR action remains obscure, hence we used the GAL4 hybrid system to identify and characterize an active transcriptional silencer in the ligand binding domain (LBD) of RVR. Rigorous deletion and mutational analysis demonstrated that this repressor domain is encoded by amino acids 416-449 of RVR. Furthermore, we demonstrated that efficient repression is dependent on the so-called LBD-specific signature motif, (F/W)AKxxxxFxxLxxxDQxxLL (which spans loop3-4 and helix 4) and helix 5 (H5; identified in the crystal structures of the steroid receptor LBDs). Although RVR is expressed in many adult tissues, including skeletal muscle, and during embryogenesis, its physiological function in differentiation and mammalian development remains unknown. Since other 'orphans', e.g. COUP-TF II and Rev-erbA alpha, have been demonstrated to regulate muscle and adipocyte differentiation, we investigated the expression and functional role of RVR during mouse myogenesis. In C2C12 myogenic cells, RVR mRNA was detected in proliferating myoblasts and was suppressed when the cells were induced to differentiate into post-mitotic, multinucleated myotubes by serum withdrawal. This decrease in RVR mRNA correlated with the appearance of muscle-specific markers (e.g. myogenin mRNA). RVR 'loss of function' studies by constitutive over-expression of a dominant negative RVR delta E resulted in increased levels of p21Cip1/Waf1 and myogenin mRNAs after serum withdrawal. Time course studies indicated that expression of RVR delta E mRNA results in the precocious induction and accumulation of myogenin and p21 mRNAs after serum withdrawal. In addition, we demonstrated that over-expression of the COUP-TF II and Rev-erbA alpha receptors in C2C12 cells completely blocked induction of p21 mRNA after serum withdrawal. In conclusion, our studies identified a potent transcriptional repression domain in RVR, characterized critical amino acids within the silencing region and provide evidence for the physiological role of RVR during myogenesis.

Amino Acid Sequence↗

PubMed1996

Transcriptional repression by Rev-erbA alpha is dependent on the signature motif and helix 5 in the ligand binding domain: silencing does not involve an interaction with N-CoR.

Rev-erbA alpha is an orphan nuclear receptor that functions as a dominant transcriptional repressor. Tissue culture and in situ hybridisation studies indicated that Rev-erbA alpha plays an important role in mammalian differentiation and development. Previous studies have localised the silencing domain of Rev-erbA alpha to the D/E region of the orphan receptor. This study utilised the GAL4 hybrid system to demonstrate that efficient repression is mediated by 34 amino acids (aa) between aa 455 and 488 in the E region of the receptor. This domain contains the ligand binding domain (LBD)-signature motif [(F/W)AKxxxxFxxLxxxDQxxLL] and a region that, according to the recently published crystal structures of steroid receptors, would be predicted to form helix 5 of the canonical LBD structure. Fine deletions and site-specific mutagenesis indicated that both the LBD signature motif and helix 5 were necessary for efficient silencing. Utilising mammalian two hybrid technology, we have also demonstrated that Rev-erbA alpha does not associate with the interaction domain (aa 2218-2451) of the nuclear receptor corepressor, N-CoR, that is known to interact with the thyroid hormone and retinoic acid receptors. This suggested that transcriptional repression by Rev-erbA alpha is not mediated through an interaction with N-CoR. In conclusion, we have identified and characterised the minimal domain of Rev-erbA alpha, that mediates transcriptional repression by this orphan receptor.

Amino Acid Sequence↗

PubMed1996

Characterization of the AB (AF-1) region in the muscle-specific retinoid X receptor-gamma: evidence that the AF-1 region functions in a cell-specific manner.

The retinoid X receptors alpha, beta and gamma (RXRs) share a highly conserved 'C' region or DNA binding domain (DBD). The conserved 'DE' region or ligand binding domain (LBD) of the RXRs is functionally complex, mediating dimerization and a ligand-dependent activation function (AF-2). The AB or N-terminal region of the RXRs is poorly conserved and encodes a ligand-independent activation function (AF-1). RXR gamma mRNA is preferentially expressed in skeletal and cardiac muscle, however, cell-specific steroid receptor-mediated trans-activation is a poorly understood phenomenon. We utilized the GAL4 hybrid assay system and have demonstrated that RXR gamma contains two functional domains in the AB and DE regions that activate transcription in a ligand-independent and -dependent manner respectively. The functions of the AB (AF-1) and DE (AF-2) domains were regulated by cAMP-dependent protein kinases, furthermore, the function of AF-2 in the LBD was activated by 8-Br-cAMP, independent of 9-cis-retinoic acid treatment. Deletion analysis demonstrated that the AF-1 of RXR gamma, is located between amino acids 1 and 103 and contained multiple motifs that were targets of cAMP-dependent protein kinases. Transfection analyses in non-muscle and myogenic cells clearly demonstrated that: (i) the AF-1 of RXR gamma functions in a muscle-specific manner and is required for optimal ligand-dependent trans-activation from an RXRE; (ii) RXR gamma trans-activates more efficiently in a myogenic background.

8-Bromo Cyclic Adenosine Monophosphate↗

PubMed1995

Sequence and expression of Sox-18 encoding a new HMG-box transcription factor.

The newly identified Sox gene family (Sry-like HMG-box gene) is characterized by a conserved DNA sequence encoding a domain of approx. 80 amino acids (aa) which is responsible for sequence-specific DNA binding. The first member isolated, the mammalian Y-linked testis-determining gene, Sry, is necessary and sufficient for male development. We report here the identification of two new members of this family, Sox-17 and 18. We have determined the full cDNA sequence of Sox-18 which encodes a protein of 378 aa. Sox-18 mRNA transcripts were restricted to heart, lung and skeletal muscle in the adult mouse.

Amino Acid Sequence↗

PubMed1995

Trans-activation and DNA-binding properties of the transcription factor, Sox-18.

Sox-18 is a member of the Sox multi-gene family (Sry-related HMG-box gene). We have bacterially expressed this 378 amino acid protein and demonstrated sequence-specific binding to the Sox DNA-binding motif AACAAAG. A distinct 95 amino acid activation domain was mapped in Sox-18 using GAL4-Sox-18 fusions (amino acids 160-225). Furthermore, Sox-18 was capable of trans-activating gene expression through the AACAAA motif. Our results suggest that Sox-18 functions as a classical trans-activator of gene expression.

Animals↗

PubMed1995

Identification of a regulatory function for an orphan receptor in muscle: COUP-TF II affects the expression of the myoD gene family during myogenesis.

COUP-TF II is an 'orphan steroid receptor' that binds a wide variety of AGGTCA repeats and represses thyroid hormone (T3) and retinoid dependent trans-activation; however, very little is known of its functional and/or developmental role during mammalian cell differentiation. T3 and retinoids have been demonstrated to promote terminal muscle differentiation via activation of the muscle specific myoD gene family (myoD, myogenin, myf-5 and MRF-4). The myoD gene family can direct the fate of mesodermal cell lineages, repress proliferation, activate differentiation and the contractile phenotype. Hence, we investigated the expression and functional role of COUP-TF II during muscle differentiation. Proliferating C2C12 myoblasts expressed COUP-TF II mRNA which was repressed when cells were induced to differentiate into post-mitotic multinucleated myotubes by serum withdrawal. Concomitant with the decrease of COUP-TF II mRNA was the appearance of muscle specific mRNAs (e.g. myogenin, alpha-actin). We show that Escherichia coli expressed full length and truncated COUP-TF II bound in a sequence specific manner to the T3 response elements (TREs) in the myoD and myogenin regulatory HLH genes [Olson (1992) Dev. Biol. 154, 261-272]; and the TRE in the skeletal alpha-actin contractile protein gene. COUP-TF II diminished the homodimeric binding of the thyroid hormone receptor and the heterodimeric binding of thyroid hormone and retinoid X receptor complexes to these TREs. Constitutive over-expression of COUP-TF II cDNA in mouse C2C12 myogenic cells suppressed the levels of myoD mRNA and blocked the induction of myogenin mRNA, whereas constitutive expression of anti-sense COUP-TF II cDNA significantly increased the steady state levels of myoD mRNA and hyper-induced myogenin mRNA. These studies demonstrate for the first time (i) that COUP-TF II, functions as a physiologically relevant antagonistic regulator of myogenesis via direct effects on the myoD gene family and (ii) direct evidence for the developmental role of COUP-TF II during mammalian cell differentiation.

Actins↗

PubMed1995

Regulation of vertebrate muscle differentiation by thyroid hormone: the role of the myoD gene family.

Skeletal myoblasts have their origin early in embryogenesis within specific somites. Determined myoblasts are committed to a myogenic fate; however, they only differentiate and express a muscle-specific phenotype after they have received the appropriate environmental signals. Once proliferating myoblasts enter the differentiation programme they withdraw from the cell cycle and form post-mitotic multinucleated myofibres (myogenesis); this transformation is accompanied by muscle-specific gene expression. Muscle development is associated with complex and diverse protein isoform transitions, generated by differential gene expression and mRNA splicing. The myofibres are in a state of dynamic adaptation in response to hormones, mechanical activity and motor innervation, which modulate differential gene expression and splicing during this functional acclimatisation. This review will focus on the profound effects of thyroid hormone on skeletal muscle, which produce alterations in gene and isoform expression, biochemical properties and morphological features that precipitate in modified contractile/mechanical characteristics. Insight into the molecular events that control these events was provided by the recent characterisation of the MyoD gene family, which encodes helix-loop-helix proteins; these activate muscle-specific transcription and serve as targets for a variety of physiological stimuli. The current hypothesis on hormonal regulation of myogenesis is that thyroid hormones (1) directly regulate the myoD and contractile protein gene families, and (2) induce thyroid hormone receptor-transcription factor interactions critical to gene expression.

Animals↗

PubMed1995

Early responses of trans-activating factors to growth hormone in preadipocytes: differential regulation of CCAAT enhancer-binding protein-beta (C/EBP beta) and C/EBP delta.

Using the 3T3-F442A preadipocyte line as a model of GH-dependent differentiation, early changes in the DNA-binding affinity of transcription factors in response to GH addition were investigated. Addition of 50 ng/ml human GH to cells in chemically defined medium led to a rapid increase in binding activity of activator protein 1 (AP-1) and CCAAT enhancer-binding protein (C/EBP), which was significant at 30 min and reached maximal induction by 2 h (3-fold for AP-1, 2.5-fold for C/EBP). Induction in AP-1 DNA binding correlates with a concomitant GH trans-activation of c-jun and c-fos genes described previously. Using specific antibodies in electrophoretic mobility shift assays and Western blots, it was shown that the increase in activity of C/EBP is the result of an increase in synthesis of two alternatively translated forms of C/EBP beta: 40-C/EBP beta and 23-C/EBP beta. This increase in protein was not accompanied by alteration in mRNA level and could be blocked by a Janus kinase 2 tyrosine kinase inhibitor and a C kinase inhibitor at concentrations shown to inhibit GH-dependent activation of microtubule-associated protein (MAP) kinases. Concomitant with the translationally activated increase in C/EBP beta, a GH-dependent increase was observed in C/EBP delta transcription. This was accompanied by an increase in mRNA for C/EBP delta, which was superinduced by cycloheximide and, unlike the increase in C/EBP beta protein, was not observed with insulin. Thus GH exerts its effects on C/EBP isoforms at two levels: transcriptional activation of C/EBP delta and translational activation of C/EBP beta. It is proposed that GH-dependent phosphorylation results in the efficient translation of 40-C/EBP beta and 23-C/EBP beta (the mouse homolog of the inhibitor liver-enriched inhibitory protein), and that together with the induction of C/EBP delta, these may be involved in initiating the adipocyte differentiation program.

3T3 Cells↗

PubMed1995

Constitutive expression of the orphan receptor, Rev-erbA alpha, inhibits muscle differentiation and abrogates the expression of the myoD gene family.

Rev-erbA alpha is an orphan steroid receptor that is expressed in skeletal muscle. Rev-erbA alpha binds to single/tandem copies of an AGGTCA motif, is transcribed on the noncoding strand of the c-erbA- alpha gene locus, and is postulated to modulate the thyroid hormone (T3) response. T3 induces terminal muscle differentiation and regulates fiber type composition via direct activation of the muscle-specific myoD gene family (e.g. myoD, myogenin). The myoD gene family can direct the fate of mesodermal cell lineages and activate muscle differentiation. Hence we investigated the expression and physiological role of Rev-erbA alpha during myogenesis. We observed abundant levels of Rev-erbA alpha mRNA in dividing C2C12 myoblasts, which were suppressed when the cells differentiated into postmitotic multinucleated myotubes. This decrease in Rev-erbA alpha mRNA correlated with the appearance of muscle-specific mRNAs (e.g. myogenin and alpha-actin). Constitutive overexpression of full length Rev-erbA alpha cDNA in the myogenic cells completely abolished differentiation, suppressed myoD mRNA levels, and abrogated the induction of myogenin mRNA. We then demonstrated that 1) GAL4-REV-erbA alpha chimeras that contain the 'AB' region and lack the 'E' region activated transcription of GAL4 response elements in the presence of 8-Br-cAMP and 2) the ligand-binding domain (LBD) contains an active transcriptional silencer. Overexpression of Rev-erbA alpha (delta AB) in myogenic cells had no impact on the ability of these cells to morphologically or biochemically differentiate. Furthermore, this orphan receptor 1) down-regulated thyroid hormone receptor (TR)/T3 mediated transcriptional activity from the myogenin promoter and thyroid hormone response element (TRE) an 2) disrupted TR homodimer and TR/retinoid X receptor (RXR) heterodimer formation on a number of TREs found in the myoD gene family. In conclusion, Rev-erbA alpha functions as a negative regulator of myogenesis by targeting the expression of the myoD gene family. The mechanism of action may involve inhibition of functional TR/RXR heterodimer formation on critical TREs and dominant trans-repression of gene expression.

Actins↗

PubMed1994

Expression vectors encoding human growth hormone (hGH) controlled by human muscle-specific promoters: prospects for regulated production of hGH delivered by myoblast transfer or intravenous injection.

We report here the construction of vectors that produce and secrete human growth hormone (hGH) in a muscle-specific manner. The promoter regions of the genes encoding human skeletal alpha-actin (HSA) and troponin I slow (HTnIs) were linked to the hGH-encoding gene. These vectors were designated pHSA2000GH and pHTnIs4200GH, respectively. The HSA and HTnIs promoters linked to the cat gene have previously been shown to be necessary and sufficient for developmentally regulated muscle-specific expression. Furthermore, these promoters function in a fibre-type-specific manner in transgenic animals. Transient and stable transfection analyses with pHSA2000GH and pHTnIs4200GH indicated that: (i) these vectors efficiently synthesized hGH in a muscle-specific manner; (ii) the myogenic master regulatory gene, myoD, a determinant of cell fate, trans-activated expression of hGH in pluripotential non-muscle cells; and (iii) these hGH expression vectors were developmentally regulated during myogenic differentiation. These regulated tissue/fibre-type-specific hGH-containing plasmids are suitable vectors for the delivery and stable production of GH in livestock and GH-deficient hosts by either transgenesis, myoblast transfer or liposome-mediated intravenous injection.

Actins↗

PubMed1994

Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the effects of triiodo-L-thyronine on in vitro myogenesis; the activation of myoD gene expression in the slow twitch fibres and the cascade of myogenic events regulated by thyroid hormone.

Animals↗

PubMed1994

The retinoic acid and retinoid X receptors are differentially expressed during myoblast differentiation.

Retinoids (all trans and 9-cis retinoic acid) are pleiotropic regulators of cell fate, and have been shown to regulate the expression of helix loop helix transcription factors (e.g MyoD, myogenin and Myf-5) that control myogenic differentiation. The effects of retinoids are mediated through the ligand dependent retinoic acid receptors (RARs) and retinoid X receptors (RXRs). We have found that the messenger RNA transcripts encoding RAR are repressed during differentiation of C2C12 myoblasts while, conversely, RXR mRNA transcripts are induced in C2C12 myotubes. These results imply that RXRs, play a major regulatory role in differentiated muscle.

Animals↗

PubMed1994

Identification of deoxyribonucleic acid sequences that bind retinoid-X receptor-gamma with high affinity.

The retinoid-X receptor (RXR) family (-alpha, -beta and -gamma) forms homodimers that bind to a number of retinoid-X response elements and trans-activate gene expression in a retinoid-dependent manner. Although, the RXRs are known to bind tandem direct repeats (DR) of the hexamer, RGGTCA, separated by 1 nucleotide, it is not known whether these represent the optimal and/or only recognition sequences. We, therefore, used a nonbiased strategy to identify sequences that efficiently bound RXR gamma, an isoform preferentially expressed in cardiac and skeletal muscle tissue. We performed binding site selection with bacterially expressed RXR gamma bound to glutathione-agarose and a pool of random sequences to derive a consensus DNA-binding site for RXR gamma. We analyzed a total of 41 individually selected oligonucleotides and found that RXR gamma bound with high affinity to motifs that were accommodated by the consensus AARGRNCAAAGGTCAA/cR. We observed that the majority of the sequences that formed complexes with RXR gamma in electrophoretic mobility shift analysis were DR-1 motifs; however, DR- motifs separated by 2, 4, and 8 nucleotides and a palindrome-0 motif were also demonstrated to interact with RXR gamma. Mutagenesis of the derived sequences indicated that both RGGTCA motifs were required for high affinity binding to RXR gamma. These derived sequences conferred appropriate 9-cis- and all-trans-retinoic acid (RA) responses to a thymidine kinase promoter. Furthermore, supershift experiments with a RXR antibody verified that these sequences specifically interacted with RXR in nuclear extracts derived from C2C12 muscle cells. In conclusion, this study rigorously defines the range of DR motifs that can recognize RXR and regulate gene expression in a RA-dependent fashion. The derived consensus accommodates retinoid-X response elements that have been identified in a diverse range of genes trans-activated by 9-cis-RA via the RXR family.

Animals↗