PubMed Health⌕ Search

Biomedical subjects

G E Muscat

Publications and source records attributed to G E Muscat.

54 records · Page 3Linked to original sources
PubMed1993

Identification of a thyroid hormone response element in the mouse myogenin gene: characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site.

Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al., Mol. Endocrinol., 6: 1185-1194, 1992). We have identified a T3 response element (TRE) in the mouse myogenin (MM) promoter between nucleotide positions -526 and -494 (5' GTGGTAGGTCTTTAGGGGTCTCATGGGACTGACA 3'). This sequence conferred appropriate hormonal regulation to an enhancerless SV40 promoter. Electrophoretic mobility shift analysis experiments showed that thyroid hormone receptor alpha (TR alpha) and retinoid X receptor alpha (RXR alpha) formed a heterodimeric complex on the MM TRE that was specifically competed by classical TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides, as predicted by the 3-4-5 rule. Electrophoretic mobility shift analysis experiments showed that the myogenin, growth hormone, and myosin heavy chain TREs interacted with an identical nuclear factor(s) in muscle cells that was constitutively expressed during myogenesis. Mutagenesis of the MM TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4-nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion, our data suggest that the MM TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed1993

Characterization of the thyroid hormone response element in the skeletal alpha-actin gene: negative regulation of T3 receptor binding by the retinoid X receptor.

We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophoretic mobility shift assay experiments showed that Escherichia coli expressed and affinity purified TR alpha bound to the skeletal alpha-actin TRE in a sequence specific manner. The alpha-actin TRE bound TR alpha dimers cooperatively. Mutagenesis of the alpha-actin TRE indicated that the core binding motifs and the gap sequences were the most important for efficient binding to TR alpha. The retinoid X receptor alpha (RXR alpha) interacted with the alpha-actin TRE in a sequence specific fashion and formed heterodimeric complexes with TR alpha on the alpha-actin TRE. However, increased levels of RXR alpha decreased the binding of TR alpha to the alpha-actin TRE, in contrast to promoting TR alpha binding to the alpha-myosin heavy chain TRE. Furthermore, the alpha-actin, palindromic, synthetic direct repeat, alpha-myosin heavy chain, and growth hormone TREs interacted with an identical nuclear factor in vitro in muscle cells. In conclusion, our data suggest that the human skeletal alpha-actin TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)

Actins↗
PubMed1992

Prenatal expression of the growth hormone (GH) receptor/binding protein in the rat: a role for GH in embryonic and fetal development?

Although fetal growth is generally considered to be independent of pituitary growth hormone (GH), it is possible that pituitary GH plays a modulatory role in organ development or that a GH-like substance of non pituitary origin may influence fetal growth through the GH receptor. Accordingly, we have used immunohistochemistry, northern blot analysis, the reverse transcriptase-polymerase chain reaction and solution hybridization to study the ontogeny of the GH receptor/binding protein (BP) from the 12-day-old embryo (E12) to the E18 rat fetus. GH receptor/BP immunoreactivity was observed in all major organ systems of the E18 rat fetus and was not preferentially associated with any germ layer derivative. A general increase in GH receptor/BP immunoreactivity was evident from E12 to E18, with a marked increase occurring between E16 and E18. Hemangioblastic tissue was, however, strongly or intensely immunoreactive at all stages of development, as was the placenta. Most noteworthy of the other tissues expressing GH receptor/BP immunoreactivity by day 18 were skeletal and smooth muscle, chondroprogenitor cells, epithelial lining cells, neuronal ganglia, ependymal cells and the adrenal cortex. In the placenta, the most prominent immunoreactivity was associated with decidual cells. Total RNA was isolated from E12 to E18 rat fetuses and adult rat liver. Northern hybridization with a 35S-labelled rat GH receptor cRNA probe revealed that 3.9 kb and 1.2 kb transcripts complementary to the rat GH receptor riboprobe are present from at least E16. The existence of GH receptor mRNA at E12 and E14 was demonstrated by the polymerase chain reaction.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed1992

The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element.

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.

Actins↗
PubMed1992

Tissue-specific expression of the skeletal alpha-actin gene involves sequences that can function independently of MyoD and Id.

The skeletal alpha-actin gene is a member of the sarcomeric contractile protein gene family and is specifically expressed in differentiated muscle. The skeletal alpha-actin gene is regulated efficiently by enhancer and regulatory sequences between nucleotide positions -1282 and -87. In the present study we have shown that the sequences 3' of nucleotide position -87 can functionally interact with the SV40 enhancer in a tissue-specific manner and can restrict the ubiquitous function of the SV40 enhancer to myogenic cells. Site-specific cassette mutagenesis was used to delimit the sequences upstream of the TATA motif (-32), between nucleotide positions -64 and -37, that mediate efficient expression in myogenic cells in the presence of the SV40 enhancer. The skeletal alpha-actin promoter was trans-activated by the helix-loop-helix (HLH) transcription factors MyoD, MRF-4, and Myogenin, in pluripotential 10T1/2 fibroblasts and trans-repressed by the HLH protein Id (inhibitor of differentiation) in myogenic C2C12 cells. This trans-regulation required sequences upstream of -87 and occurred independently of the two consensus E boxes (CANNTG) at positions +18 and +71. The -64/-37 region interacted with purified Sp1 and an unidentified protein(s), proximal regulatory factor(s) I (PRF-I). We conclude that the muscle-specific expression of the skeletal alpha-actin promoter is not simply determined by MyoD elements and enhancer and regulatory sequences, but that the minimal promoter contains important determinants of cell-specific transcription that can function independently of the helix-loop-helix transcription factors.

Actins↗
PubMed1992

The human skeletal alpha-actin gene is regulated by a muscle-specific enhancer that binds three nuclear factors.

The tissue-specific distal promoter of the human skeletal alpha-actin gene (-1282 to -708) induces transcription in myogenic cells approximately 10-fold and, with the most proximal promoter domain (-153 to -87), it synergistically increases transcription 100-fold (Muscat and Kedes 1987). We report here that it is a short fragment of the distal promoter, the distal regulatory element (DRE) from -1282 to -1177 that functions as a muscle-specific, composite enhancer. An internal deletion in the DRE (delta -1282/-1151) in the context of the full-length 2000 bp promoter, resulted in a 10-fold reduction in transcription. Three distinct nuclear proteins, DRF-1, DRF-2, and DRF-3, interact specifically with the DRE between positions -1260 and -1193. A site specific mutation that abolishes DRF-2 binding also results in a 10-fold reduction in transcriptional activity. The DRF-2 nuclear protein has characteristics similar to those of the muscle-specific regulatory factor, MEF-2 (Buskin and Hauschka 1989; Gossett et al., 1989). Like the MEF-2 binding site in the muscle creatine kinase enhancer, the critical DRF-2 binding site is also an A/T-rich sequence element. The DRF-2 nuclear protein binds equally well to the MCK MEF-2 binding site and to the A/T-rich regulatory element of the skeletal muscle fast-twitch troponin C gene (Gahlmann and Kedes 1990). Furthermore, this troponin C site competes in vivo for DRF-2 driven expression of the skeletal alpha-actin gene in C2 cells. The DRF-2 site alone, however, does not activate transcription in muscle cells when linked to the SV40 promoter. We conclude that the DRF-2 binding element is a MEF-2 binding site that is required but insufficient for regulation of muscle-specific skeletal alpha-actin gene expression by the DRE. Thus, muscle-specific regulation of the human skeletal alpha-actin gene appears to require interactions between the other elements of the composite DRE enhancer with the protein:DNA complex formed by DRF-2.

Actins↗
PubMed1991

Proliferin, a prolactin/growth hormone-like peptide represses myogenic-specific transcription by the suppression of an essential serum response factor-like DNA-binding activity.

Proliferin (PLF), a protein which has homology to PRL and GH, has been implicated in the regulation of cell growth and differentiation. PLF1 was detected and found to be differentially regulated during myogenesis in the rodent myogenic cell line C2C12. Transient and stable constitutive high level expression of PLF1 repressed expression of the transfected cardiac and skeletal alpha-actin myogenic-specific promoters, but did not affect expression of the cytoskeletal beta-actin and several viral promoters linked to CAT. Stable cotransfection analyses of 5' unidirectionally deleted actin promoters and a PLF expression vector indicated that PLF exerted its effect on transcription down-stream of nucleotide positions -177 and -154 with respect to the start of transcription at 1 in the cardiac and skeletal alpha-actin promoters. Analyses of cells stably transfected with PLF showed reduced levels of MyoD mRNA, a recently identified gene that is sufficient to convert pluripotential 10T1/2 cells into myoblasts. However, transient constitutive expression of MyoD by the Moloney sarcoma virus long terminal repeat did not override the effect of PLF. Electrophoretic mobility shift analysis of nuclear extracts from C2C12 cells stably transfected with a PLF expression vector displayed drastically reduced levels or activity of the CArG-binding factor (CBF) relative to the ubiquitously expressed transcription factor Oct-1. High affinity interaction between CBF and alpha-actin promoter sequences in vitro directly correlates with functional in vivo expression. CBF is a transcription factor that is sufficient and necessary for myogenic-specific transcription, interacts with the promoter sequences targeted by PLF, and is immunologically related to the serum response factor. In conclusion, PLF selectively represses myogenic-specific transcription within the actin multigene family by suppressing the level and/or activity of a trans-acting factor (CBF) that modulates multiple muscle-specific genes. The data provide a molecular explanation for the inhibition of differentiation by an endogenously produced growth factor/hormone that is differentially expressed during myogenesis and a physiologically important antagonistic regulator of muscle-specific transcription.

Actins↗
PubMed1988

Adenovirus E1A products suppress myogenic differentiation and inhibit transcription from muscle-specific promoters.

The primary function of the adenovirus E1A-region genes is to activate other adenoviral genes during a permissive viral infection by modifying the host cell transcriptional apparatus. Host cell immortalization, or transformation by the whole adenoviral early region, presumably results as a consequence of these modifications. Both transcriptional activation and transcriptional repression of non-adenoviral genes by the E1A proteins have been reported. It is currently not clear which, if either, of these activities contributes to host cell transformation and immortalization. Although there may be a physiological impact of some E1A-stimulated host cell genes, in many cases the functional significance is unclear. No common target sequences have been recognized in stimulated cellular genes and it has recently been proposed that in many cases, particularly involving newly transfected genes, available 'TATA-box' sequences may be the opportunistic beneficiaries of E1A assistance as a secondary consequence of E1A primary functions within the host cell nucleus. E1A-mediated transcriptional repression appears to be a more specific process insofar as common core elements are shared by the E1A-suppressed SV40, polyoma B, IgG heavy-chain and insulin enhancers. In the present communication we report that the complete myogenic programme of L8 and C2 myoblasts can be blocked by the introduction of constitutively expressing E1A genes, and show that the transcriptional induction of muscle-specific genes is inhibited. In particular, the promoter-inducing activities of well-defined elements that are required for the muscle-specific expression of the two sarcomeric alpha-actins, and which normally bind cellular trans-acting factors, become targets for E1A suppression. The results support the hypothesis that the suppression of differentiation by E1A products is effected by an E1A-mediated block in the transcriptional activation of cellular genes by specific developmentally regulated cis-acting promoter elements.

Adenovirus Early Proteins↗
PubMed1988

Nucleotide sequence and expression of the human skeletal alpha-actin gene: evolution of functional regulatory domains.

Regulation of the actin multigene family involves the recognition of regulatory sequences that specify the tissue type and developmental program of expression for each actin isotype. In order to investigate the underlying regulatory mechanisms, the human skeletal alpha-actin gene and its 5' regulatory region have been cloned and sequenced. This actin gene has seven exons; there is one large intron in the 5' untranslated region which is characteristic of the actins and many muscle-specific genes. The 5' flanking sequences are sufficient to direct tissue-specific and differentiation-regulated expression when transfected into the heterologous rat L8 myogenic cells, indicating a highly conserved regulatory system. The DNA sequence was compared to that of other actin genes, and several regions of sequence similarity were identified, particularly within regions known to be important for gene expression. Most notable among the conserved sequences are the CC(A/T rich)6GG (CArG box) motifs which have demonstrated interactions with trans-acting transcriptional factors. This same motif has been identified in several other genes and in some also serves as a binding site for transcription regulatory factors.

Actins↗
PubMed1988

A common factor regulates skeletal and cardiac alpha-actin gene transcription in muscle.

The skeletal and cardiac alpha-actin genes are coexpressed in muscle development but exhibit distinctive tissue-specific patterns of expression. We used an in vivo competition assay and an in vitro electrophoretic mobility shift assay to demonstrate that both genes interact with a common trans-acting factor(s). However, there was at least one gene-specific cis-acting sequence in the skeletal alpha-actin gene that interacted with a trans-acting factor which was not rate limiting in the expression of the cardiac alpha-actin gene. The common factor(s) interacted with several cis-acting regions that corresponded to sequences that are required for the transcriptional modulation of these sarcomeric alpha-actin genes in muscle cells. These regulatory regions contained the sequence motif CC(A + T-rich)6GG, which is known as a CArG box. Results of in vivo competition assays demonstrated that the factor(s) bound by the skeletal alpha-actin gene is also essential for the maximal activity of the cardiac alpha-actin, simian virus 40 (SV40), alpha 2(I)-collagen, and the beta-actin promoters in muscle cells. In contrast, fibroblastic cells contained functionally distinct transcription factor(s) that were used by the SV40 enhancer but that did not interact with the sarcomeric alpha-actin cis-acting sequences. The existence of functionally different factors in these cell types may explain the myogenic specificity of these sarcomeric alpha-actin genes. Results of in vitro studies suggested that both the sarcomeric alpha-actin genes interact with the CArG box-binding factor CBF and that the skeletal alpha-actin promoter contains multiple CBF-binding sites. In contrast, CBF did not interact in vitro with a classical CAAT box, the SV40 enhancer, or a linker scanner mutation of an alpha-actin CArG box. Furthermore, methylation interference and DNase I footprinting assays demonstrated the precise sites of interaction of CBF with three CArG motifs at positions -98, -179, and -225 in the human skeletal alpha-actin gene.

Actins↗
PubMed1987

Multiple 5'-flanking regions of the human alpha-skeletal actin gene synergistically modulate muscle-specific expression.

Transfection into myogenic and nonmyogenic cell lines was used to investigate the transcriptional regulation of the human alpha-skeletal actin gene. We demonstrated that 1,300 base pairs of the 5'-flanking region directed high-level transient expression of the bacterial chloramphenicol acetyltransferase gene in differentiated mouse C2C12 and rat L8 myotubes but not in mouse nonmuscle L.TK- and HuT-12 cells. Unidirectional 5' deletion analysis and heterologous promoter stimulation experiments demonstrated that at least three transcription-regulating subdomains lie in this 1,300-base-pair region. A proximal cis-acting transcriptional element located between positions -153 and -87 relative to the start of transcription at +1 was both sufficient and necessary for muscle-specific expression and developmental regulation during myogenesis in the two myogenic cell systems. The region 3' of position -87 interacted with factors present in both myogenic and fibroblastic cells and appeared to define, or to be a major component of, the basal promoter. In C2C12 myotubes, but not in L8 myotubes, a distal sequence domain between positions -1300 and -626 and the proximal sequence domain between positions -153 and -87 each induced transcription about 10-fold and synergistically increased CAT expression 100-fold over levels achieved by the sequences 3' of position -87. Furthermore, these cis-acting elements independently and synergistically modulated an enhancerless, heterologous simian virus 40 promoter in a tissue-specific manner. DNA fragments which included the proximal domain displayed classical enhancerlike properties. The central region between positions -626 and -153, although required in neither cell line, had a positive, two- to threefold, additive role in augmenting expression in L8 cells but not in C2C12 cells. This suggests that certain elements between positions -1300 and -153 appear to be differentially utilized for maximal expression in different myogenic cells and that the particular combination of domains used is dependent on the availability, in kind or amount, of trans-acting, transcription-modulating factors present in each cell type. Thus, multiple myogenic factors that vary qualitatively and quantitatively may be responsible for the different and complex modulatory programs of actin gene expression observed during in vivo muscle differentiation.

Actins↗
PubMed1985

Growth-related changes in specific mRNAs upon lectin activation of human lymphocytes.

A cDNA library in lambda gt10 was constructed from the cytoplasmic poly(A) +RNA of human peripheral blood lymphocytes after 72 hr of phytohemagglutinin stimulation, with the aim of assessing selective gene expression as a result of lymphocyte activation. Thirteen recombinants were isolated by the use of an enriched probe and differential screening. These clones were categorized into two groups with respect to their hybridization to mRNA. In the first group three recombinants were isolated, which hybridized to single discrete mRNAs in the size range 0.7-1.7 kb. The mRNAs corresponding to these clones were present at elevated levels in activated lymphocytes, but the kinetics of increase differed. The 0.7-kb mRNA coded for by clone p1L1 increased two-fold at 6 hr and remained elevated over 72 hr, as did beta-actin mRNA. The 1.7-kb mRNA coded for by clone p9L2 increased two- to three-fold after 6 hr and was maximally expressed after 24 hr exposure to phytohemagglutinin, coincident with the onset of DNA replication, and maintained this level up to 72 hr. The 1.0-kb mRNA coded by p10L2F which was rare in resting cells increased 25- to 30-fold after 6 hr, prior to overall transcriptional increases and reached peak levels after 72 hr when a substantial proportion of the cells were in the S and G2 + M phases of the cell cycle. This clone was undetectable or very rare in the leukemic T-lymphoblast cell line CCRF-CEM. The second group of clones, consisting of the remaining 10 recombinants, did not hybridize to discrete bands, but to a smear on RNA blots.(ABSTRACT TRUNCATED AT 250 WORDS)

Actins↗
PubMed1984

Changes in levels of actin and tubulin mRNAs upon the lectin activation of lymphocytes.

The expression of beta-actin, gamma-actin, alpha-tubulin, and beta-tubulin mRNA during the lectin activation of human peripheral blood lymphocytes was examined with specific cDNA clones. The resting lymphocyte has a low level of both alpha- and beta-tubulin mRNAs, and these increase 10-fold after 72 h of lectin stimulation in which maximum cell transformation is achieved. Although there is a slight increase in tubulin mRNA during the first 6 h, most of the increase occurs between 6 and 24 h as the cells start to increase their RNA content and progress from G0 into G1. Both beta- and gamma-actin mRNAs are more abundant than the tubulin mRNAs in resting cells, with beta-actin mRNA being the major species. Upon activation, beta-actin mRNA increases threefold, whereas gamma-actin mRNA increases almost sixfold. Both beta- and gamma-actin mRNA are elevated 2.5-fold as early as 6 h, the gamma-actin mRNA level then increasing more than beta-actin between 6 and 24 h, resulting in the reduced beta-actin/gamma-actin mRNA ratio. The lectin-stimulated lymphocyte has a similar beta-actin/gamma-actin mRNA ratio as that of the human leukemic T-lymphoblast cell line CCRF-CEM. These increases are over and above the general increase in polyadenylated RNA content upon lectin activation. On returning to a noncycling state, the levels of these cytoskeletal mRNAs decrease. There were two beta-tubulin mRNAs present in lymphocyte cytoplasm, one of 1.8 kilobases and one of 2.8 kilobases in length. The nongrowing lymphocytes had relatively lower levels of the larger sized mRNA. Upon stimulation, the relative level of the larger mRNA was increased, and at 72 h the cells had approximately equal levels of both mRNAs as did the leukemic lymphoblasts.

Actins↗
PubMed1983

The effects of lectin transformation on cytoplasmic polyadenylated RNA from human lymphocytes.

The translational activity of cytoplasmic poly(A)+ RNA from resting human lymphocytes was approximately 20% of that from phytohemagglutinin-transformed lymphocytes in a rabbit reticulocyte lysate assay. Translation assays in the presence of cap analogues suggested that the mRNA from resting cells was relatively deficient in functional 5'-terminal cap structures. Neither mRNA fraction inhibited the translation of globin mRNA in the cell-free assay, and both preparations were essentially pure as shown by hybridisation with [3H]poly(U). The size distribution and poly(A) tail length of poly(A)+ RNA was similar in the resting and transformed cell and both preparations directed the synthesis of peptides of molecular weight 15 000 to 90 000. Two dimensional gels of total proteins from resting and transformed lymphocytes showed predominantly quantitative changes. However cross-hydridising cDNA and mRNA from resting and transformed cells after the common sequences have been removed by hydroxylapatite chromatography showed that about 4% of the cytoplasmic poly(A)+ RNA from transformed lymphocytes was not present in resting cells. This difference may result from transformation-specific gene expression.

Cells, Cultured↗
PubMed1983

Terminal incorporation of 2'-deoxyadenosine into polyadenylate segments of polyadenylated RNA in G1-phase-arrested human T-lymphoblasts.

In the presence of the adenosine deaminase inhibitor erythro-9-[3(2-hydroxynonyl)]adenine microM concentrations of 2'-deoxyadenosine (dAdo) are toxic to nondividing human lymphoid cells and induce G1-phase arrest in T-leukemic lymphoblasts, effects which appear to be independent of ribonucleotide reductase inhibition by accumulated 2'-deoxyadenosine 5'-triphosphate. We sought to determine if 2'-deoxyadenosine 5'-triphosphate had effects similar to those of other cytotoxic adenosine analogues which are incorporated into polyadenylated RNA [poly(A)+ RNA]. In the presence of erythro-9-[3-(2-hydroxynonyl)]adenine, 8-14C]dAdo, at minimal cytostatic concentrations, was incorporated into the polyadenylate segments of cytoplasmic poly(A)+ RNA in the human T-leukemic lymphoblast line CCRF-CEM, and 70% of incorporated dAdo was in the 3'-terminal position. No DAdo was found in enzyme hydrolysates of nonpolyadenylated regions of poly(A)+ RNA or of poly(A)-RNA. Enzymic hydrolysis of polyadenylated segments from labeled poly(A)+ RNA yielded adenosine:dAdo ratios of approximately 55:1.

Adenine↗
PubMedDate not supplied

Transcriptional repression by COUP-TF II is dependent on the C-terminal domain and involves the N-CoR variant, RIP13delta1.

COUP-TF II/ARP-1 is an 'orphan' steroid receptor that inhibits basal transcription, and represses trans-activation by the vitamin D, thyroid hormone and retinoid receptors. The molecular basis of repression by COUP-TF II remains obscure. In this study we utilized the GAL4 hybrid system to demonstrate that COUP-TF II contains sequences within the C-terminal region that encode a dominant transcriptional repressor that inhibits the ability of the potent chimeric transactivator GAL4VP16 to induce transcription. Mammalian two hybrid analysis demonstrated that COUP-TF II did not efficiently interact with either interaction domains I or II from N-CoR and RIP13. However, COUP-TF II efficiently interacts with a region comprised of interaction domains I + II from the corepressor, RIP13delta1. Efficient interaction of the orphan receptor with the corepressor was critically dependent on a large region comprised of the C, D and E domains of COUP-TF II, which correlated with the domain that maximally represses transcription. This investigation suggested that the N-CoR variant, RIP13delta1 interacts with a region of COUP-TF II that functions as a dominant transcriptional repressor.

8-Bromo Cyclic Adenosine Monophosphate↗