PubMed Health⌕ Search

Biomedical subjects

J Trapman

Publications and source records attributed to J Trapman.

At least 37 records · Page 2Linked to original sources
PubMed1997

Androgen-regulated gene expression in prostate cancer.

Androgen-regulated gene expression is mediated by the ligand-activated androgen receptor. Androgen receptor target genes contain in the regulatory regions one or more androgen response elements. Development of the male urogenital tract, including the prostate, depends on an activated androgen receptor. Similarly, growth of the majority of prostate cancers is androgen-dependent. Therefore, endocrine therapy, aimed at inhibition of androgen receptor functioning, has been applied for many years. However, during therapy, apparently androgen receptor independent cancers continue to grow. In general, these tumors still express the androgen receptor, suggesting a functional role of the androgen receptor. In a proportion of late stage prostate tumors, mutations and amplification of the androgen receptor gene have been found. Additionally, it has been hypothesized that ligand-independent androgen receptor activation can be involved in hormone refractory prostate cancer.

Androgens↗
PubMed1997

Molecular analysis of the androgen-receptor gene in a family with receptor-positive partial androgen insensitivity: an unusual type of intronic mutation.

In the coding part and the intron-exon boundaries of the androgen-receptor gene of a patient with partial androgen insensitivity, no mutation was found. The androgen receptor of this patient displayed normal ligand-binding parameters and migrated as a 110-112-kD doublet on SDS-PAGE in the absence of hormone. However, after culturing of the patient's genital skin fibroblasts in the presence of hormone, the slower-migrating 114-kD protein, which reflects hormone-dependent phosphorylation, was hardly detectable. Furthermore, receptor protein was undetectable in the nuclear fraction of the fibroblasts, after treatment with hormone, which is indicative of defective DNA binding. By sequencing part of intron 2, a T-->A mutation was found 11 bp upstream of exon 3. In our screening of 102 chromosomes from unrelated individuals, this base-pair substitution was not found, indicating that it was not a polymorphism. mRNA analysis revealed that splicing involved a cryptic splice site, located 71/70 bp upstream of exon 3, resulting in generation of mRNA with an insert of 69 nucleotides. In addition, a small amount of a transcript with a deleted exon 3 and a very low level of wild-type transcript were detected. Translation of the extended transcript resulted in an androgen-receptor protein with 23 amino acid residues inserted between the two zinc clusters, displaying defective DNA binding and defective transcription activation.

Androgen-Insensitivity Syndrome↗
PubMed1997

Both androgen receptor and glucocorticoid receptor are able to induce prostate-specific antigen expression, but differ in their growth-stimulating properties of LNCaP cells.

Androgen receptor-positive LNCaP cells were stably transfected with a rat glucocorticoid receptor (GR) expression plasmid. Ligand-binding studies in the generated cell lines revealed high-affinity binding of the cognate ligands to their receptors. Transfection experiments with the newly derived cell lines showed that, like androgen receptor, GR can induce activity of a prostate-specific antigen promoter fragment linked to the luciferase gene. Similarly, dexamethasone can stimulate expression of endogenous prostate-specific antigen messenger RNA. Cell proliferation could be induced by R1881. In contrast, dexamethasone treatment of the GR-positive sublines had no stimulatory effect on cell growth. Using the differential display technique, a so far unknown complementary DNA fragment, designated 21.1, specifically induced by androgens and not by glucocorticoids, has been identified. In conclusion, the newly generated cell lines, together with the parental LNCaP cell line, form an attractive system with which to study the mechanism of specificity of steroid hormone regulation of gene expression.

Androgens↗
PubMed1997

An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter.

Prostate-specific antigen (PSA) is expressed at a high level in the luminal epithelial cells of the prostate and is absent or expressed at very low levels in other tissues. PSA expression can be regulated by androgens. Previously, two functional androgen-response elements were identified in the proximal promoter of the PSA gene. To detect additional, more distal control elements, DNasel-hypersensitive sites (DHSs) upstream of the PSA gene were mapped in chromatin from the prostate-derived cell line LNCaP grown in the presence and absence of the synthetic androgen R1881. In a region 4.8 to 3.8 kb upstream of the transcription start site of the PSA gene, a cluster of three DHSs was detected. The middle DNAseI-hypersensitive site (DHSII, at approximately -4.2 kb) showed strong androgen responsiveness in LNCaP cells and was absent in chromatin from HeLa cells. Further analysis of the region encompassing DHSII provided evidence for the presence of a complex, androgen-responsive and cell-specific enhancer. In transient transfected LNCaP cells, PSA promoter constructs containing this upstream enhancer region showed approximately 3000-fold higher activity in the presence than in the absence of R1881. The core region of the enhancer could be mapped within a 440-bp fragment. The enhancer showed synergistic cooperation with the proximal PSA promoter and was found to be composed of at least three separate regulatory regions. In the center, a functionally active, high-affinity androgen receptor binding site (GGAACATATTGTATC) could be identified. Mutation of this element almost completely abolished PSA promoter activity. Transfection experiments in prostate and nonprostate cell lines showed largely LNCaP cell specificity of the upstream enhancer region, although some activity was found in the T47D mammary tumor cell line.

Androgens↗
PubMed1997

A 6-kb promoter fragment mimics in transgenic mice the prostate-specific and androgen-regulated expression of the endogenous prostate-specific antigen gene in humans.

Prostate-specific antigen (PSA) is a kallikrein-like serine protease, which is almost exclusively synthesized in the luminal epithelial cells of the human prostate. PSA expression is androgen regulated. Previously, we characterized in vitro the proximal promoter, and a strong enhancer region, approximately 4 kb upstream of the PSA gene. Both regions are needed for high, androgen-regulated activity of the PSA promoter in LNCaP cells. The goal of the present study is the in vivo characterization of the PSA promoter. Three transgenic mouse lines carrying the Escherichia coli LacZ gene, driven by the 632-bp proximal PSA promoter, and three lines with LacZ, driven by the 6-kb PSA promoter, were generated. Expression of the LacZ reporter gene was analyzed in a large series of tissues. Transgene expression could not be demonstrated in any of the transgenic animals carrying the proximal PSA promoter. All three lines carrying the 6-kb PSA promoter showed lateral prostate-specific beta-galactosidase activity. Transgene expression was undetectable until 8 weeks after birth. Upon castration, beta-galactosidase activity rapidly declined. It could be restored by subsequent androgen administration. A search for mouse PSA-related kallikrein genes expressed in the prostate led to the identification of mGK22, which was previously demonstrated to be expressed in the submandibular salivary gland. Therefore, the 6-kb PSA-LacZ transgene followed the expression pattern of the PSA gene in humans, which is almost completely prostate-specific, rather than that of mGK22 in mice. In conclusion, the 6-kb promoter fragment appears to contain most, if not all, information for androgen regulation and prostate specificity of the PSA gene.

Animals↗
PubMed1997

A novel gene which is up-regulated during colon epithelial cell differentiation and down-regulated in colorectal neoplasms.

To identify new molecular markers for differentiation of normal and neoplastic colon epithelium, we have studied changes in gene expression during the in vitro differentiation of the HT29-D4 colon carcinoma cell line. Using a modified differential display procedure, we cloned a novel cDNA, designated differentiation-related gene 1 (Drg1). Drg1 mRNA has a length of approximately 3 kb and is induced approximately 20-fold during in vitro differentiation of the colon carcinoma cell lines HT29-D4 and Caco-2. The absence of Drg1 induction in growth-inhibited A431 epidermoid carcinoma cells indicates that Drg1 up-regulation in colon carcinoma cells is not a result of decreased proliferation. The Drg1 cDNA contains an open-reading frame of 1182 bp that encodes a protein with a predicted molecular weight of 43 kd. Drg1 mRNA is expressed most prominently in placental membranes and prostate, kidney, small intestine, and ovary tissues. Compared to normal colon mucosa, Drg1 mRNA expression is decreased in colon adenomas and adenocarcinomas. An antiserum raised against recombinant Drg1 protein detected a band of the expected size in Western blots. Immunohistochemistry showed that in normal colon Drg1 protein is expressed in the cytoplasm and basolateral membranes of surface epithelial cells that border the gut lumen, indicating that Drg1 protein is expressed late during differentiation, just before apoptosis and shedding of cells into the colon lumen.

Amino Acid Sequence↗
PubMed1997

The Wilms' tumor gene WT1 can regulate genes involved in sex determination and differentiation: SRY, Müllerian-inhibiting substance, and the androgen receptor.

Genital abnormalities associated with Wilms' tumors in the WAGR and Denys-Drash syndromes and the failure of the gonads to develop in Wilms' tumor gene (wt1)-homozygous mutant mice suggest that WT1 may also function in sexual development. To elucidate the mechanism of action of WT1 in embryonal sexual development, we examined how the four isoforms of WT1 regulate the transcription of several genes involved in sexual development using cotransfection assays. SRY (the sex-determining region of the Y chromosome) promoter was strongly activated by the WT1 isoforms without the KTS tripeptide, WT1(-)KTS, but was not activated by the WT1 isoforms with the KTS tripeptide, WT1(+)KTS, in all cells tested. The second alternative splicing site, which inserts the tripeptide KTS, alters the DNA binding capability. The MüAdullerian-inhibiting substance (MIS) promoter was strongly repressed by WT1(-)KTS isoforms and more weakly repressed by the WT1(+)KTS isoforms in Sertoli cells but not in HeLa cells. The androgen receptor (AR) promoter was strongly repressed by the WT1(-)KTS isoforms in all cells tested and was more weakly or not repressed by WT1(+)KTS isoforms depending on cell lines. Electrophoretic mobility shift assays showed strong binding by recombinant WT1(-)KTS protein and weaker or no binding by the WT1(+)KTS protein to DNA probes containing WT1 binding sites from these three promoters. The results of these functional and binding assays suggest that WT1 has an important role in regulation of genes involved in embryonal sexual development and that WT1 can function as a transcriptional activator.

Animals↗
PubMed1996

Tissue specific and androgen-regulated expression of human prostate-specific transglutaminase.

Transglutaminases (TGases) are calcium-dependent enzymes catalysing the post-translational cross-linking of proteins. In the prostate at least two TGases are present, the ubiquitously expressed tissue-type TGase (TGC), and a prostate-restricted TGase (TGP). This paper deals with the molecular cloning and characterization of the cDNA encoding the human prostate TGase (hTGP). For this purpose we have screened a human prostate cDNA library with a probe from the active-site region of TGC. The largest isolated cDNA contained an open reading frame encoding a protein of 684 amino acids with a predicted molecular mass of 77 kDa as confirmed by in vitro transcription-translation and subsequent SDS/PAGE. The hTGP gene was tissue-specifically expressed in the prostate, yielding an mRNA of approx. 3.5 kb. Furthermore, a 3-fold androgen-induced upregulation of hTGP mRNA expression has been demonstrated in the recently developed human prostate cancer cell line, PC346C. Other well established human prostate cancer cell lines, LNCaP and PC-3, showed no detectable hTGP mRNA expression on a Northern bolt. The gene coding for prostate TGase was assigned to chromosome 3.

Amino Acid Sequence↗
PubMed1996

Androgen regulation of the rat keratinocyte growth factor (KGF/FGF7) promoter.

Keratinocyte Growth Factor (KGF/FGF7) is a candidate andromedin in normal embryonic development of male accessory sex glands, such as the prostate and seminal vesicles. The expression of KGF mRNA and protein is androgen-responsive. To elucidate the regulation of expression of the KGF gene, we isolated the first two exons of the KGF gene and approximately 15 kb upstream sequences. The major transcription start site was mapped. It is preceded by a CAAT-box and a TATA-box. Transient transfections in LNCaP cells revealed that, upon treatment with the synthetic androgen R1881, KGF promoter activity is upregulated 6 to 11 fold, indicating androgen regulation of the KGF promoter in the region from position - 900 to -1200. The longest construct (BH-pLuc: -4700 to +901) has a much higher basal activity than the shorter constructs, indicating that in the region -4700 to -2700 additional activating sequences are present.

Androgens↗
PubMed1996

Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter.

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity.

Androgens↗
PubMed1996

Molecular basis of androgen insensitivity.

Male sexual differentiation and development proceed under direct control of androgens. Androgen action is mediated by the intracellular androgen receptor, which belongs to the superfamily of ligand-dependent transcription factors. In the X-linked androgen insensitivity syndrome, defects in the androgen receptor gene have prevented the normal development of both internal and external male structures in 46, XY individuals. The complete form of androgen insensitivity syndrome is characterized by 46, XY karyotype, external female phenotype, intra-abdominal testes, absence of uterus and ovaries, blindly ending vagina, and gynecomastia. There is also a group of disorders of androgen action that result from partial impairment of androgen receptor function. Clinical indications can be abnormal sexual development of individuals with a predominant male phenotype with severe hypospadias and micropenis or of individuals with a predominantly female phenotype with cliteromegaly, ambiguous genitalia, and gynecomastia. Complete or gross deletions of the androgen receptor gene have not been frequently found in persons with the complete androgen insensitivity syndrome, whereas point mutations at several different sites in exons 2-8 encoding the DNA- and androgen-binding domain have been reported in both partial and complete forms of androgen insensitivity, with a relatively high number of mutations in two clusters in exons 5 and 7. The number of mutations in exon 1 is extremely low, and no mutations have been reported in the hinge region, located between the DNA-binding domain and the ligand-binding domain. The X-linked condition of spinal and bulbar muscle atrophy (Kennedy's disease) is characterized by a progressive motor neuron degeneration associated with signs of androgen insensitivity and infertility. The molecular cause of spinal and bulbar muscle atrophy is an expanded length (> 40 residues) of one of the polyglutamine stretches in the N-terminal domain of the androgen receptor.

Amino Acid Sequence↗
PubMed1996

Molecular basis of androgen insensitivity.

Mutations in the androgen receptor gene in 46,XY individuals can be associated with the androgen insensitivity syndrome, of which the phenotype can vary from a female phenotype to an undervirilized or infertile male phenotype. We have studied the androgen receptor gene of androgen insensitivity patients to get information about amino acid residues or regions involved in DNA binding and transcription activation. Genomic DNA was analysed by PCR-SSCP under two different conditions. Three new mutations were found in exon 1 of three patients with a female phenotype. A cytosine insertion at codon 42 resulted in a frameshift and consequently in the introduction of a premature stop at codon 171. Deletion of an adenine at codon 263 gave rise to a premature stop at codon 292. In both these cases, receptor protein was not detectable and hormone binding was not measurable. In a third patient, a guanine-to-adenine transition at codon 493 converted a tryptophan codon into a stop codon. Genital skin fibroblasts from this patient were not available. In exon 2 of the androgen receptor gene of a patient with receptor-positive androgen insensitivity, a cytosine-to-adenine transition, converting alanine 564 into an aspartic acid residue, resulted in defective DNA binding and transactivation. In three other receptor-positive androgen insensitivity patients no mutations were found with PCR-SSCP.

Amino Acid Sequence↗
PubMed1996

The androgen receptor in prostate cancer.

The androgen receptor is a member of the family of nuclear receptors. In its activated form as an androgen receptor ligand complex (the ligand can either be testosterone or 5a-dihydrotestosterone), the androgen receptor is able to regulate a specific expression of target genes. The androgen receptor is expressed at high levels in male reproductive tissues. Mutations in the androgen receptor gene are the molecular cause of the androgen insensitivity syndrome, which is characterized by an aberrant male or an apparently female phenotype. Expansion of a CAG-repeat, encoding a polymorphic glutamine stretch is the cause of a rare motor neuron disease (Kennedy's disease). Hormonal therapy is the treatment of choice for metastatic prostate cancer. Hormone refractory prostate tumors in general still express androgen receptor. In a proportion of the late stage prostate tumors, somatic mutations in the androgen receptor gene have been described. Mutations can result in diminished ligand specificity of the androgen receptor. Furthermore, it has been hypothesized that ligand independent mechanisms can also be involved in androgen receptor activation.

Carcinoma↗
PubMed1995

Identification of mRNAs that show modulated expression during colon carcinoma cell differentiation.

To investigate the working hypotheses that stem cells or their early descendants are prime targets for neoplastic transformation, and that the degree to which a neoplasm retains the immature phenotype is an important determinant of tumor aggressiveness, we have identified several mRNAs that are downregulated during the in vitro differentiation of HT29-D4 colon carcinoma cells. These genes include heat-shock cognate protein Hsc70, adenylosuccinate lyase, B23/nucleophosmin, alpha-tubulin, and a novel gene designated DS-1. The DS-1 mRNA has a length of approximately 0.9 kb and is downregulated 4.7-fold upon differentiation. From the DS-1 cDNA, a protein of 206 amino acids with a molecular mass of 24 kDa and an isoelectric point of 10.9 can be deduced. An antiserum directed against a synthetic peptide detected a minor band of the expected size in Western blots, as well as a major band of lower size that may represent a processed form of the protein.

Adenylosuccinate Lyase↗
PubMed1995

Isolation, properties and chromosomal localization of four closely linked hamster interferon-alpha-encoding genes.

Three recombinant phages containing hamster interferon-alpha-encoding genes (Ha Ifa) were isolated from a Ha genomic library, using a murine (Mu) Ifa probe. The phage inserts contained overlapping genomic fragments which span a total length of approx. 30 kb, on which four Ha Ifa genes are localized. The Ifa gene cluster could be assigned to hamster chromosome 2q. The nt sequences of the four Ifa genes were determined. Two of the genes are functional (Ha Ifa-1 and Ifa-3) and two are pseudogenes (Ifa-ps2 and Ifa-ps4). Ha Ifa-1 and -3 were transiently expressed in COS cells and they gave rise to protein products (A1 and A3, respectively) with antiviral properties on hamster CHO cells. In addition, Ha A1 revealed high antiviral activity on murine L929 cells.

Amino Acid Sequence↗
PubMed1995

Combinatorial association and abundance of components of interferon-stimulated gene factor 3 dictate the selectivity of interferon responses.

Genes containing the interferon-stimulated response element (ISRE) enhancer have been characterized as transcriptionally responsive primarily to type I interferons (IFN alpha/beta). Induction is due to activation of a multimeric transcription factor, interferon-stimulated gene factor 3 (ISGF3), which is activated by IFN alpha/beta but not by IFN gamma. We found that ISRE-containing genes were induced by IFN gamma as well as by IFN alpha in Vero cells. The IFN gamma response was dependent on the ISRE and was accentuated by preexposure of cells to IFN alpha, a treatment that increases the abundance of ISGF3 components. Overexpression of ISGF3 polypeptides showed that the IFN gamma response depended on the DNA-binding protein ISGF3 gamma (p48) as well as on the 91-kDa protein STAT91 (Stat1 alpha). The transcriptional response to IFN alpha required the 113-kDa protein STAT113 (Stat2) in addition to STAT91 and p48. Mutant fibrosarcoma cells deficient in each component of ISGF3 were used to confirm that IFN gamma induction of an ISRE reporter required p48 and STAT91, but not STAT113. A complex containing p48 and phosphorylated STAT91 but lacking STAT113 bound the ISRE in vitro. IFN gamma-induced activation of this complex, preferentially formed at high concentrations of p48 and STAT91, may explain some of the overlapping responses to IFN alpha and IFN gamma.

Animals↗
PubMed1995

Synergism between androgens and protein kinase-C on androgen-regulated gene expression.

Androgen (R1881) induced transcriptional activity of the human androgen receptor, stably expressed in CHO cells, can be stimulated an extra 2-fold by the addition of the protein kinase C activator, 4 beta-phorbol 12-myristate 13-acetate (PMA). This extra stimulation is not observed when the protein kinase A activator bromoadenosine 3':5'-cyclic monophosphate (8-BrcAMP) is used. The transcriptional activity was measured using a reporter plasmid containing the MMTV-promoter, coupled to the luciferase gene. The effect of PMA on R1881-induced transcription was not due to a higher expression level of the androgen receptor. Also, no extra phosphorylation of the androgen receptor could be measured after incubation with PMA. When GRE-tk-LUC and PSA-LUC reporters were used, the synergistic effect of PMA could not be observed. The findings on the composite MMTV-LTR promoter can be explained by either a direct synergistic interaction between occupied AP-1 like responsive elements and the androgen receptor or via an unknown transcription factor activated by the PKC pathway and interacting with the androgen receptor.

Animals↗