PubMed Health⌕ Search

Biomedical subjects

K Shimada

Publications and source records attributed to K Shimada.

At least 19 recordsLinked to original sources
PubMed1992

Photoaffinity labeling of the phylloquinone-binding polypeptides by 2-azidoanthraquinone in photosystem I particles.

A photoaffinity label, 2-azido-9,10-anthraquinone, binds at the quinone-binding (Q phi) site with high affinity and can substitute for the secondary acceptor, phylloquinone, in photosystem I reaction center of spinach. Phylloquinone-depleted photosystem I particles reconstituted with azido[3H]anthraquinone were illuminated with UV light and analyzed by sodium dodecylsulfate-polyacrylamide gel electrophoresis. The large core polypeptides (psaA and/or psaB) were selectively labeled. The labeling was competitively inhibited in the presence of anthraquinone. These results indicate that the Q phi site is located on psaA or psaB polypeptides.

Affinity Labels↗
PubMed1992

Detection and quantification of anti-Ki antibodies by enzyme-linked immunosorbent assay using recombinant Ki antigen.

OBJECTIVE: To establish an enzyme-linked immunosorbent assay (ELISA) for detecting anti-Ki antibody, using a bovine recombinant Ki antigen, and studying its specificity. METHODS: Sera from 220 patients with various connective tissue diseases were screened, and a prospective study of fluctuations in anti-Ki antibody and clinical course of a woman with systemic lupus erythematosus (SLE) was analyzed, by ELISA: RESULTS: Anti-Ki antibodies were present in 18.9% of patients with SLE. The titer of anti-Ki antibody in the woman with SLE rose before the onset of pericarditis and pleuritis in this longitudinal study. CONCLUSION: ELISA using a recombinant Ki antigen is useful for the diagnosis of SLE, and it might be useful in estimating disease activity in patients with SLE.

Animals↗
PubMed1992

In vitro susceptibility of clinical isolates of Bacteroides fragilis and Bacteroides thetaiotaomicron in Japan.

A nationwide survey of the susceptibility of 433 isolates of Bacteroides fragilis and 149 isolates of Bacteroides thetaiotaomicron was conducted from December 1986 through November 1989 in Japan. These strains were collected from 16 university hospitals and one metropolitan hospital. Metronidazole was the most active drug against both species, with no resistant isolates found. The activity of imipenem and sulbactam-cefoperazone was good, with very low resistance rates determined in Bacteroides fragilis (1.4% and 1.6%, respectively) and in Bacteroides thetaiotaomicron (3.4% for both drugs), and was comparable to that of metronidazole. Cefoxitin, cefmetazole, cefotetan, cefbuperazone, latamoxef and ceftizoxime were found to be more active against Bacteroides fragilis, for which resistance rates were 3.2 to 9.5%, than against Bacteroides thetaiotaomicron, for which resistance rates were 18.1 to 21.8%. Rates of piperacillin resistance in the two species were 12.9% and 26.8%, respectively. Clindamycin was very active at a low concentration (MIC50 of 0.39 to 1.56 mg/l), but 24% and 27.5% of Bacteroides fragilis and Bacteroides thetaiotaomicron isolates, respectively, were resistant to this agent.

Anti-Bacterial Agents↗
PubMed1992

Serum interleukin 6 levels become elevated in acute myocardial infarction.

We have examined serum interleukin 6 (IL-6) levels in 12 patients with acute myocardial infarction (AMI). IL-6 levels became elevated in all patients, following the rise of serum creatine kinase (CK) activity. Peak IL-6 levels showed a good correlation with peak serum C-reactive protein (CRP) levels, while there was no direct relationship between peak IL-6 levels and peak CK activity. IL-6 mRNA was not detected in unstimulated "quiescent" rat cardiocytes cultured in serum-free medium, but its expression was induced by exposure of the cells to serum or ionomycin. These results show that IL-6 is synthesized in the myocardium and serum IL-6 levels become elevated in AMI, suggesting that IL-6 could affect the progression and/or healing processes of AMI.

Aged↗
PubMed1992

Production and specificity of antisera raised against 25-hydroxyvitamin D3-[C-3]-bovine serum albumin conjugates.

In order to obtain specific antisera for use in the enzyme immunoassay of 25-hydroxyvitamin D3, three hapten-carrier conjugates having different lengths of bridges at the C-3 position were prepared from 25-hydroxyvitamin D3 by coupling with bovine serum albumin using the active ester method. The specificity of anti-25-hydroxyvitamin D3 antisera elicited in rabbits was tested by a cross-reaction study with closely related secosterols and by measuring the plasma levels of 25-hydroxyvitamin D3 by means of radioimmunoassay using tritium-labeled antigen. The results indicated that the specificity of the antisera obtained is higher than that of vitamin D-binding protein, and that some of these antisera are suitable for enzyme immunoassay.

Animals↗
PubMed1992

Enhanced spontaneous calcium efflux and decrease of calcium-dependent calcium release from the isolated perfused heart of spontaneously hypertensive rats.

OBJECTIVE: The aim of this study was to clarify the further details of calcium handling in hypertension. DESIGN: By preserving the physiological environment of cell membrane, whole hearts were used for comparison of calcium flux between spontaneously hypertensive rats (SHR) and Wistar-Kyoto (WKY) rats. METHODS: Hearts from SHR and WKY rats were perfused with Krebs-Henseleit solution under constant flow and the effluent collected. RESULTS: After labelling of the heart with 45Ca2+ (100 mumol/l), 45Ca2+ binding was found to be saturated, and washing with calcium-free perfusion solution showed two exponential curves for calcium dissociation, indicating a fast (alpha-) and slow (beta-) phase. The half-lives of the beta-phase for both 4- and 8-week-old SHR were significantly shorter than those for age-matched WKY. Also in this phase, infusion of non-radioactive Ca2+ caused a transient dose-dependent release of 45Ca2+. A significant reduction in the amount of 45Ca2+ release induced by 2 mmol/l Ca2+ was observed in both 4- and 8-week-old SHR compared with age-matched WKY rats. Infusion of lanthanum, caffeine, ionomycin (calcium ionophore) and treatment of the hearts with ethyleneglycol-bis-(beta-aminoethylether)-N,N,N,',N'-tetraac etic acid did not alter 45Ca2+ release by non-radioactive Ca2+. From these observations, 45Ca2+ is presumably released from the intracellular calcium pool, and not from extracellular binding sites or sarcoplasmic reticulum. CONCLUSIONS: These findings suggest that an abnormal calcium-handling defect (enhanced calcium efflux and reduction of membrane-bound Ca2+) exists under physiological conditions before and after the onset of hypertension, and that this may be a primary characteristic of SHR.

Aging↗
PubMed1992

Disseminated Pneumocystis carinii infection in a hemophiliac patient with acquired immunodeficiency syndrome.

A case of disseminated Pneumocystis carinii (PC) infection in a 28-year-old Japanese male hemophiliac with acquired immunodeficiency syndrome (AIDS) is reported. The patient had displayed a high fever and diffuse faint interstitial infiltrates on chest X-ray films without dyspnea three months before his death. At that time, no PC was detected after four consecutive induced sputum tests. Serum anti-cytomegalovirus (CMV) IgM was positive by EIA. No treatment for PC and CMV was given at the patient's request. Autopsy findings disclosed disseminated PC infection consisting of granulomas with caseation-like necrosis and frothy exudate in the lungs and disseminated organized calcification in the blood vessels of extrapulmonary organs. PC cysts and/or trophozoites were detected in these lesions.

Acquired Immunodeficiency Syndrome↗
PubMed1992

[Identification of mycobacteria by the acridinium-ester labeled DNA probes for M. tuberculosis and M. avium-intracellulare complex in culture and its clinical application].

The detectability of mycobacterium in culture by non-isotopic, chemiluminescent DNA probes for Mycobacterium tuberculosis (M. tuberculosis) and M. avium-intracellulare complex (MAC) was evaluated and compared with that by 125I-labeled DNA probe for the same mycobacteria. The sensitivity and specificity of the AE-DNA probes for MAC were 97.2% and 100%, respectively, for the conventional method and were both 100% for the 125I-labeled DNA probes. The detection limits of the AE-DNA probes tests for both M. tuberculosis and MAC were 10(5)-10(6) CFU/tube which were almost the same as those of the 125I-labeled DNA probes tests. Because the procedure is simple, rapid (it can be completed within 90 min), and safe (it does not use radioisotopes), it can be easily performed in any clinical laboratory.

Acridines↗
PubMed1992

Chromosomal localization of the mouse prealbumin gene (Ttr) by in situ hybridization.

Prealbumin is a serum protein which plays an important role in plasma transport of retinol and thyroxine. The accumulation of a variant prealbumin is associated with a hereditary disorder, familial amyloidotic polyneuropathy (FAP). In situ hybridization with a mouse prealbumin gene cDNA probe was carried out in mouse fibroblasts. Analysis of 114 R-banded metaphases showed that 13% of the total grains were located on chromosome 4 and 46% of the grains on this chromosome were in the region C6-D1. Linkage and syntenic group analysis showed that the prealbumin gene (Ttr) is located between two syntenic groups on mouse chromosome 4, which corresponded to two syntenic groups present on human chromosomes 1 and 9.

Animals↗
PubMed1992

Conduction disturbance and pacemaker therapy in patients with corrected transposition of the great arteries.

We observed 4 adult patients with corrected transposition of the great arteries (CTGA) who developed complete atrioventricular block: of 4 patients, 2 received endocardial pacemakers (DDD mode), 1 an epicardial pacemaker (VVI mode), and 1 patient did not have a permanent pacemaker implantation. Endocardial lead fixation in the systemic venous atrium and ventricle is adequate to provide permanent electrode stability in patients with CTGA.

Adult↗
PubMed1992

Human platelet-derived transforming growth factor-beta stimulates synthesis of glycosaminoglycans in cultured porcine aortic endothelial cells.

Human platelet-derived transforming growth factor-beta (TGF-beta) stimulated the incorporation of [35S]sulfate into glycosaminoglycans (GAGs) both in the medium and on the cell surface of cultured aortic endothelial cells in a dose- and time-dependent manner. TGF-beta inhibited the suppression of GAG synthesis by other cytokines. TGF-beta increased the protein synthesis, while reducing the DNA synthesis by endothelial cells. The proportion of anticoagulant heparan sulfate in total GAGs was reduced. Thus, TGF-beta affected the endothelial GAG metabolism both quantitatively and qualitatively.

Animals↗
PubMed1992

Production and specificity of anti-22-oxacalcitriol antisera.

22-Oxacalcitriol 3-hemiglutarate, a haptenic derivative of 22-oxacalcitriol, was synthesized to obtain a specific antibody for use in radioimmunoassay. Three antisera were elicited in rabbits against the hapten conjugated with bovine serum albumin, and their specificity was examined by cross-reaction study. One of the antisera was found to be satisfactorily specific, and expected to provide a radioimmunoassay useful for the pharmacokinetic study of 22-oxacalcitriol.

Animals↗
PubMed1992

Effects of removal of chicks from hens on concentrations of prolactin, luteinizing hormone and oestradiol in plasma of brooding Gifujidori hens.

Gifujidori hens were allowed to repeat a breeding cycle in one season. In the first breeding cycle the duration of the brooding (raising chicks) stage was limited to 3 weeks, whereas in the second breeding cycle it was limited to 1 week by removing all chicks from mother hens. In the first breeding cycle, plasma prolactin (PRL) was high during the incubation period, but rapidly decreased on the day of hatching and reached minimum values about 1 week after hatching. In contrast, plasma luteinizing hormone (LH) concentrations were low during the incubation period, but after hatching they gradually increased and reached peak values immediately after removal of chicks. Concentrations of oestradiol in plasma were low in the incubation and brooding stages but increased significantly immediately after removal of chicks. In the second breeding cycle, changes in PRL and LH concentrations were similar to those observed in the first breeding cycle except that even greater increases in plasma LH and oestradiol concentrations were observed one week after hatching when the chicks were removed. These results suggest that coexistence of newly hatched chicks may suppress LH secretion from the pituitary of the hen in the natural breeding cycle.

Animals↗
PubMed1992

Clinical application of the polymerase chain reaction for a rapid diagnosis of Mycobacterium tuberculosis infection.

A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3'. The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conventional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.

AIDS-Related Opportunistic Infections↗
PubMed1992

A randomized trial of reduced doses of azidothymidine in Japanese patients with human immunodeficiency virus type 1 infection.

Adverse reactions to the standard dose (1,200 mg/day-1,500 mg/day) of azidothymidine (AZT) are serious. An in vitro pharmacokinetic study of intracellular AZT-5'-triphosphate suggested the feasibility of a clinical trial with reduced doses of AZT. A randomized trial with reduced doses of AZT (group A; 400 mg/day, n = 15, group B; 800 mg/day, n = 13), was conducted enrolling 28 patients with human immunodeficiency virus infection. The effective rate of AZT on CD4+ lymphocyte counts was similar for both groups, but the duration of the effect of AZT was significantly longer in group A (p less than 0.05). In group B, adverse reactions were more frequently observed (p less than 0.01), and AZT was withdrawn or the dose was reduced more frequently (p less than 0.05). These results suggest that AZT at a dose of 400 mg/day is less toxic, and is more beneficial for long-term treatment.

Adolescent↗
PubMed1992

Endotracheobronchial lidocaine concentrations during flexible fiberoptic bronchoscopy (FFB).

Lidocaine concentrations in 49 endotracheobronchial aspirates ranged from 12,580 to 23 micrograms/ml. The aspirates taken from the larger airway contained higher concentrations of lidocaine than those obtained from the smaller airway. Of the aspirates collected before 10 minutes after the final lidocaine administration, the lidocaine concentration of 7 (24.1%) of 29 specimens was greater than 3,000 micrograms/ml, however, in the aspirates collected after 10 minutes, only 1 (5%) of 20 specimens showed a concentration greater than 3,000 micrograms/ml. Using the dilution technique method (DTM) of lidocaine in the fiberscope (FS) suction channel, gradual injection of a 2 ml saline solution into the suction channel and removal of the saline solution in the suction channel were performed immediately with a suction machine; the statistically significant differences (p < 0.001) between lidocaine concentrations in the specimens before and after the DTM procedure were determined.

Administration, Oral↗