PubMed Health⌕ Search

Biomedical subjects

K Shimada

Publications and source records attributed to K Shimada.

At least 37 records · Page 2Linked to original sources
PubMed1992

Analysis of the tendinous structure in human masticatory muscles.

In the masticatory muscles, the development of bundles of the tendon was examined: they were composed of many collagen fibers and a few elastic fibers. In the masseter muscle, the property of the tendon differs in the distribution and size of collagen fibers and elastic fibers in comparison with those of other masticatory muscles. This difference is concerned with the kinetic force for the stress or the stretch of each tendon and muscle during jaw movement.

Aged↗
PubMed1992

Conduction disturbance and pacemaker therapy in patients with corrected transposition of the great arteries.

We observed 4 adult patients with corrected transposition of the great arteries (CTGA) who developed complete atrioventricular block: of 4 patients, 2 received endocardial pacemakers (DDD mode), 1 an epicardial pacemaker (VVI mode), and 1 patient did not have a permanent pacemaker implantation. Endocardial lead fixation in the systemic venous atrium and ventricle is adequate to provide permanent electrode stability in patients with CTGA.

Adult↗
PubMed1992

Human platelet-derived transforming growth factor-beta stimulates synthesis of glycosaminoglycans in cultured porcine aortic endothelial cells.

Human platelet-derived transforming growth factor-beta (TGF-beta) stimulated the incorporation of [35S]sulfate into glycosaminoglycans (GAGs) both in the medium and on the cell surface of cultured aortic endothelial cells in a dose- and time-dependent manner. TGF-beta inhibited the suppression of GAG synthesis by other cytokines. TGF-beta increased the protein synthesis, while reducing the DNA synthesis by endothelial cells. The proportion of anticoagulant heparan sulfate in total GAGs was reduced. Thus, TGF-beta affected the endothelial GAG metabolism both quantitatively and qualitatively.

Animals↗
PubMed1992

Incidental brain lesions on magnetic resonance imaging and neurobehavioral functions in the apparently healthy elderly.

BACKGROUND AND PURPOSE: Controversies exist whether incidental neuroradiological brain lesions in the elderly are associated with depressed neuropsychological function. To address this important issue in a cross-sectional study, we related brain lesions on magnetic resonance imaging to a variety of cognitive and neurobehavioral function tests in an independent, normal elderly population. METHODS: We studied 73 independent asymptomatic elderly individuals (mean +/- SD age 70 +/- 6 years) to determine the relations between degree of brain atrophy, location and number of "lacunes," and grade of periventricular hyperintense lesions with a variety of cognitive and neurobehavioral function scores. RESULTS: We found that severity of neuroradiological changes increased while neuropsychological function scores declined with age. After adjustment for the effect of age, advanced periventricular hyperintensities, but not brain atrophy or patchy "lacunar" lesions, were associated with declines in all neuropsychological functions tested. CONCLUSION: We conclude that incidental advanced periventricular diffuse or patchy white matter changes may play a role in the development of cognitive and neurobehavioral impairments in apparently normal elderly persons.

Aged↗
PubMed1992

Production and specificity of anti-22-oxacalcitriol antisera.

22-Oxacalcitriol 3-hemiglutarate, a haptenic derivative of 22-oxacalcitriol, was synthesized to obtain a specific antibody for use in radioimmunoassay. Three antisera were elicited in rabbits against the hapten conjugated with bovine serum albumin, and their specificity was examined by cross-reaction study. One of the antisera was found to be satisfactorily specific, and expected to provide a radioimmunoassay useful for the pharmacokinetic study of 22-oxacalcitriol.

Animals↗
PubMed1992

Long-term survival in aged patients with corrected transposition of the great arteries.

Corrected transposition of the great arteries is a rare condition, and few patients with this abnormality survive past 50 years of age because of associated congenital defects or the subsequent development of atrioventricular valvular insufficiency or heart block or both. We describe four men with uncomplicated C-TGA. Our patients are of interest for the following reasons: (a) their condition is very rare; (b) the diagnosis of C-TGA traditionally has been verified through invasive cardiac catheterization procedures; however, in our latest two patients, recently developed noninvasive diagnostic techniques played the decisive role in the diagnosis of C-TGA; (c) in these modalities, they presented as a "natural experimental model" that the right ventricle submitted to a high systemic pressure load is capable of increasing muscle mass over long-term adaptation. Our four patients illustrate that patients with C-TGA, even with the associated cardiac anomalies, may live a normal life span with proper management.

Aged↗
PubMed1992

Effects of removal of chicks from hens on concentrations of prolactin, luteinizing hormone and oestradiol in plasma of brooding Gifujidori hens.

Gifujidori hens were allowed to repeat a breeding cycle in one season. In the first breeding cycle the duration of the brooding (raising chicks) stage was limited to 3 weeks, whereas in the second breeding cycle it was limited to 1 week by removing all chicks from mother hens. In the first breeding cycle, plasma prolactin (PRL) was high during the incubation period, but rapidly decreased on the day of hatching and reached minimum values about 1 week after hatching. In contrast, plasma luteinizing hormone (LH) concentrations were low during the incubation period, but after hatching they gradually increased and reached peak values immediately after removal of chicks. Concentrations of oestradiol in plasma were low in the incubation and brooding stages but increased significantly immediately after removal of chicks. In the second breeding cycle, changes in PRL and LH concentrations were similar to those observed in the first breeding cycle except that even greater increases in plasma LH and oestradiol concentrations were observed one week after hatching when the chicks were removed. These results suggest that coexistence of newly hatched chicks may suppress LH secretion from the pituitary of the hen in the natural breeding cycle.

Animals↗
PubMed1992

Clinical application of the polymerase chain reaction for a rapid diagnosis of Mycobacterium tuberculosis infection.

A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3'. The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conventional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.

AIDS-Related Opportunistic Infections↗
PubMed1992

A randomized trial of reduced doses of azidothymidine in Japanese patients with human immunodeficiency virus type 1 infection.

Adverse reactions to the standard dose (1,200 mg/day-1,500 mg/day) of azidothymidine (AZT) are serious. An in vitro pharmacokinetic study of intracellular AZT-5'-triphosphate suggested the feasibility of a clinical trial with reduced doses of AZT. A randomized trial with reduced doses of AZT (group A; 400 mg/day, n = 15, group B; 800 mg/day, n = 13), was conducted enrolling 28 patients with human immunodeficiency virus infection. The effective rate of AZT on CD4+ lymphocyte counts was similar for both groups, but the duration of the effect of AZT was significantly longer in group A (p less than 0.05). In group B, adverse reactions were more frequently observed (p less than 0.01), and AZT was withdrawn or the dose was reduced more frequently (p less than 0.05). These results suggest that AZT at a dose of 400 mg/day is less toxic, and is more beneficial for long-term treatment.

Adolescent↗
PubMed1992

Endotracheobronchial lidocaine concentrations during flexible fiberoptic bronchoscopy (FFB).

Lidocaine concentrations in 49 endotracheobronchial aspirates ranged from 12,580 to 23 micrograms/ml. The aspirates taken from the larger airway contained higher concentrations of lidocaine than those obtained from the smaller airway. Of the aspirates collected before 10 minutes after the final lidocaine administration, the lidocaine concentration of 7 (24.1%) of 29 specimens was greater than 3,000 micrograms/ml, however, in the aspirates collected after 10 minutes, only 1 (5%) of 20 specimens showed a concentration greater than 3,000 micrograms/ml. Using the dilution technique method (DTM) of lidocaine in the fiberscope (FS) suction channel, gradual injection of a 2 ml saline solution into the suction channel and removal of the saline solution in the suction channel were performed immediately with a suction machine; the statistically significant differences (p < 0.001) between lidocaine concentrations in the specimens before and after the DTM procedure were determined.

Administration, Oral↗
PubMed1992

Excitatory and inhibitory controls of the masseter and temporal muscles elicited from teeth in the rat.

The periodontal mechanism that controls the jaw reflexes was examined in lightly anesthetized rats. Motor-unit activity in the masseter and temporal muscles was recorded electromyographically and pressure stimulation was applied to either an upper incisor or an upper molar. Reflex effects of dental stimulation varied depending on the level of ongoing activity (background activity, BGA) in each motor unit. Incisal or molar stimulation elicited excitatory reflexes in both the masseter and temporal motor units at a low BGA, but inhibitory reflexes in both types of motor unit at a higher BGA. In contrast to these synergistic reflex actions, the reciprocal reflex actions of the two motor units that belonged to the respective muscles occurred when the BGA was intermediate. The results suggest that different patterns of periodontal jaw reflexes may be elicited, depending on the different levels of BGAs. Furthermore, the present reflexes were modified with the site of a stimulated tooth within the dentition. Incisal stimulation produced greater excitation in the masseter motor unit than in the temporal one, and the opposite type of response occurred during molar stimulation. Moreover, smaller-amplitude motor units with a low reflex threshold and larger-amplitude motor units with a higher reflex threshold tended to exhibit excitatory and inhibitory reflexes, respectively.

Animals↗
PubMed1992

Nucleotide sequence of the third cytokine LD78 gene and mapping of all three LD78 gene loci to human chromosome 17.

Cytokine LD78 is a member of a newly identified cytokine superfamily. We cloned the third human gene for the LD78, termed LD78 gamma and the sequence analysis showed that it is a 5'-truncated pseudogene. Exons 2 and 3 and the intron between them are highly homologous to those of the LD78 beta gene, hence, the gamma gene was probably derived from the beta gene. Southern blot analysis of human x mouse somatic hybrid cell DNAs and in situ hybridization experiments mapped all the three gene loci on human chromosome 17q21.1-q21.3. Analysis of DNAs from family members supports our previous finding that the beta and gamma genes on each of the paired chromosome 17 vary in copy number and that the LD78 alpha gene is presumably a single copy. In our analyses of cosmid clones, the LD78 beta gene and the second gene for AT744, which is also a member of the superfamily are closely linked in a head-to-head arrangement. The mechanism of generation of the three LD78 genes is discussed.

Base Sequence↗
PubMed1992

[Management of multicystic dysplastic kidney detected in perinatal periods].

We analyzed 17 cases of multicystic dysplastic kidney (MCDK) to document the natural history of MCDK and its management. One patient was nephrectomied for respiratory failure associated with MCDK. Follow-up studies of 14 kidneys revealed that 5 kidneys (36%) did not change in size, 7 kidneys (50%) decreased in size. Two kidneys (14%) increased in size during the follow up periods and were nephrectomized. Hypertension and malignancy was not observed in our cases. Evaluations for the contralateral kidney and urinary tract system were performed in 15 patients and 5 (33%) revealed abnormalities--two patients with VUR, 1 with PUJ stenosis, 1 with ureteral stricture and 1 with ectopic ureterocele. In our hospital, the management for MCDK is conservative in most cases. Nephrectomy is indicated when there are complications resulting from the size of MCDK, or when the kidney continues to increase in size after the second year of life.

Female↗
PubMed1992

Matlystatins, new inhibitors of typeIV collagenases from Actinomadura atramentaria. II. Biological activities.

Matlystatin A, the main component of matlystatins, inhibits 92 kDa and 72 kDa typeIV collagenases with IC50 values of 0.3 microM and 0.56 microM, respectively, while 7- to 11-fold greater concentrations are required to inhibit thermolysin and aminopeptidase M. The inhibition is reversible and competitive with respect to gelatin. It inhibits the invasion of basement membrane Matrigel by human fibrosarcoma HT1080 dose-dependently with an IC50 value of 21.6 microM.

Acetylcysteine↗
PubMed1992

Benign tumors of the liver resected because of a diagnosis of malignancy.

Thirty-two benign hepatic lesions, which were resected because of a diagnosis of malignancy, were reviewed to demonstrate the characteristics of the problem and to consider the best course of management. The preoperative diagnoses included 21 hepatocellular carcinomas, six metastases and five others. As the final diagnosis, hemangioma and focal nodular hyperplasia were the two major lesions mimicking malignancy, accounting for seven and six patients, respectively. Four of seven hemangiomas were atypical, with a considerable amount of fibrosis. Focal nodular hyperplasia and adenoma were misdiagnosed as hepatocellular carcinoma among other malignancies. Two instances each of necrotic tissue and hemangioma were diagnosed as metastatic carcinoma. The lesions that were studied had main features, including a diameter of less than 4 centimeters in 23 patients, evident discrepancy among the roentgenologic diagnoses in 25 patients and no rapid increase in size in 28 patients. Four of nine needle biopsies performed gave false-positive results and did not always provide adequate information. It was concluded that 15 of the 32 patients, who satisfied the aforementioned three criteria, could have been observed more carefully. However, in the other 17 patients, surgical intervention was considered justified because of an indication of a higher likelihood of a real malignancy.

Adenoma↗
PubMed1992

Surgical treatment of intrahepatic cholangiocarcinoma: four patients surviving more than five years.

BACKGROUND: To find the rational surgical strategy for the treatment of intrahepatic cholangiocarcinoma (ICC), clinical features of ICC were studied in 20 patients who underwent hepatic resection in the National Cancer Center Hospital from 1980 to 1990. METHODS: According to the morphologic pattern, we classified the ICCs into two subcategories, mass-forming and infiltrating, which correlated with their biologic behavior. RESULTS: Of 10 patients who underwent hepatectomy for mass-forming ICC, three survived more than 5 years without recurrence. The 1-, 3-, and 5-year survival rates were 59.3%, 44.4%, and 44.4%, respectively. Of 10 patients who underwent hepatectomy for infiltrating ICC, one survived more than 5 years without recurrence. The 1-, 3-, and 5-year survival rates were 72.0%, 27.0%, and 27.0%, respectively. The pathologic findings and recurrences indicated that the salient feature of the mass-forming type was its tendency for intrahepatic metastasis especially near a main lesion, and of the infiltrating type was the infiltrative spread via Glisson's capsule and hilar lymph nodal metastasis. CONCLUSIONS: An anatomic and extensive liver resection should be performed for mass-forming ICC, whereas a hepatectomy with excision of the extrahepatic bile duct and hilar lymph nodal dissection is recommended for infiltrating ICC.

Adenoma, Bile Duct↗