PubMed Health⌕ Search

Biomedical subjects

M Downes

Publications and source records attributed to M Downes.

At least 37 records · Page 2Linked to original sources
PubMed1998

A histone deacetylase corepressor complex regulates the Notch signal transduction pathway.

The Delta-Notch signal transduction pathway has widespread roles in animal development in which it appears to control cell fate. CBF1/RBP-Jkappa, the mammalian homolog of Drosophila Suppressor of Hairless [Su(H)], switches from a transcriptional repressor to an activator upon Notch activation. The mechanism whereby Notch regulates this switch is not clear. In this report we show that prior to induction CBF1/RBP-Jkappa interacts with a corepressor complex containing SMRT (silencing mediator of retinoid and thyroid hormone receptors) and the histone deacetylase HDAC-1. This complex binds via the CBF1 repression domain, and mutants defective in repression fail to interact with the complex. Activation by Notch disrupts the formation of the repressor complex, thus establishing a molecular basis for the Notch switch. Finally, ESR-1, a Xenopus gene activated by Notch and X-Su(H), is induced in animal caps treated with TSA, an inhibitor of HDAC-1. The functional role for the SMRT/HDAC-1 complex in CBF1/RBP-Jkappa regulation reveals a novel genetic switch in which extracellular ligands control the status of critical nuclear cofactor complexes.

3T3 Cells↗
PubMed1998

The corepressor N-CoR and its variants RIP13a and RIP13Delta1 directly interact with the basal transcription factors TFIIB, TAFII32 and TAFII70.

Repression of transcription by the classical nuclear receptors (e.g. TR, RAR), the orphan nuclear receptors (e.g. Rev-erbAalpha/beta), Mxi-1 and Mad bHLH-zip proteins and the oncoproteins PLZF and LAZ3/BCL6 is mediated by the corepressors N-CoR and SMRT. The interaction of the corepressors with the components involved in chromatin remodelling, such as the recruiting proteins Sin3A/B and the histone deacteylases HDAc-1 and RPD3, has been analysed in detail. The N-CoR/Sin3/HDAc complexes have a key role in the regulation of cellular proliferation and differentiation. However, the interaction of these corepressors with the basal transcriptional machinery has remained obscure. In this study we demonstrated that the N-terminalrepression domains and the receptor interactiondomains (RID) of N-CoR and its splice variants, RIP13a and RIP13Delta1, directly interact with TAFII32 in vivo and in vitro . We show that interaction domain II within the N-CoR and RIP13a RID is required for the interaction with TAFII32. We also observed that N-CoR directly interacts with each of the basal factors, TFIIB and TAFII70, and can simultaneously interact with all three basal factors in a non-competitive manner. Furthermore, we provide evidence that suggests the RVR/Rev-erbbeta-corepressor complex also interacts with the general transcriptional machinery, and that the physicalassociation of TFIIB with N-CoR also occurs in the presence of Sin3B and HDAc-1. Interestingly, we observed that N-CoR expression ablated the functional interaction between TFIIB and TAFII32 that is critical to the initiation of transcription. In conclusion, this study demonstrates that the N-terminal repressor region and the C-terminal RIDs are part of the corepressor contact interface that mediates the interaction with the general transcription factors, and demonstrates that TAFs can also directly interact with corepressors to mediate signals from repressors to the basal machinery. We also suggest that N-CoR interacts with the central components of the transcriptional initiation process (TFIIB, TAFs) and locks them into a non-functional complex or conformation that is not conducive to transcription.

Animals↗
PubMed1998

Identification and characterization of a novel corepressor interaction region in RVR and Rev-erbA alpha.

Rev-erbA alpha and RVR are orphan nuclear receptors that function as dominant transcriptional silencers. Ligand-independent repression of transcription by Rev-erbA alpha and RVR is mediated by the nuclear receptor corepressors, N-CoR and its variants RIP (RXR interacting protein) 13a and RIP13 delta 1. The physical association between the corepressors and Rev-erbA alpha and RVR is dependent on the presence of a receptor interaction domain (RID) in the N-CoR family. Our previous study demonstrated that the E region of RVR and Rev-erbA alpha is necessary and sufficient for the in vivo interaction with the nuclear receptor corepressor, RIP13 delta 1. The present investigation demonstrates that two corepressor interaction regions, CIR-1 and CIR-2, separated by approximately 150 amino acids in the E region of RVR, are required for the interaction with N-CoR, RIP13a, and RIP13 delta A. The D region is not required for the physical interaction. In contrast, the D and E regions of Rev-erbA alpha were necessary for the interaction with the N-CoR and RIP13a-RIDs in vivo, suggesting that RIP13 delta 1 and N-CoR/RIP13a differentially interact with Rev-erbA alpha. Mutagenesis of CIR-1, a novel domain that is highly conserved between RVR and Rev-erbA alpha, demonstrated that the N-terminal portion of helix 3 plays a key role and is absolutely necessary for the interaction with RIP13 delta 1, RIP13a, and N-CoR. The phenylalanine residues, F402 and F441, in RVR and Rev-erbA alpha, respectively, were critical residues in supporting corepressor interaction. Cotransfection studies demonstrated that repression of a physiological target, the human Rev-erbA alpha promoter, by RVR was significantly impaired by mutation of CIR-1 or deletion of CIR-2. Furthermore, overexpression of either the N-CoR/RIP13a or RIP13 delta 1-RIDs alleviated RVR-mediated repression of the Rev-erbA alpha promoter, demonstrating that corepressor binding mediates the repression of a native target gene by RVR. A minimal region containing juxtapositioned CIR-1 and CIR-2 was sufficient for corepressor binding and transcriptional repression. In conclusion, our study has identified a new corepressor interaction region, CIR-1, in the N terminus of helix 3 in the E region of RVR and Rev-erbA alpha, that is required for transcriptional silencing. Furthermore, we provide evidence that CIR-1 and CIR-2 may form a single corepressor interaction interface.

Amino Acid Sequence↗
PubMed1998

Virtual environments for training critical skills in laparoscopic surgery.

Surgical training simulations must incorporate not only advanced technical features, such as detailed geometric organ models and physically-based modeling techniques, but also a thorough understanding of the major training issues relating to a particular procedure. We have developed a prototype environment for training laparoscopic cholecystectomy, or gallbladder removal surgery, which focuses a student's attention on the critical steps performed during the procedure and provides feedback as to the common errors committed during a session. The current version of our system runs in real-time on a mid-range graphics workstation. The simulation also provides a platform for research into a variety of different areas, including tissue modeling, finite element methods, and generalized simulation authoring.

Algorithms↗
PubMed1997

Design variability in web geometry of an orb-weaving spider.

We studied the effect of several variables (environmental and physiological) on web geometry in the garden cross spider Araneus diadematus. Variables were: web support, wind, temperature, humidity, and silk supply. All had an effect. The spiders generally attempted to fit their webs to the shape of the supporting frame (standard, small, vertical, or horizontal). Windy conditions (0.5 m s-1) during web construction caused spiders to build smaller and rounder webs, laying down fewer capture spirals while increasing the distances between capture-spiral meshes. Decreasing temperature from 24 degrees to 12 degrees C caused the capture spiral to have fewer and wider spaced meshes, which did not change overall capture area but reduced the length of capture-spiral threads laid down. Subsequent increase of temperature to 24 degrees C restored the number of meshes laid down, but the wider mesh was retained, causing the capture area to be increased over initial control values. Decreased humidity (from 70 to 20% rH) had the effect of reducing web and capture-spiral size, the latter by reducing mesh number while keeping mesh spacing constant. Subsequent increase of humidity to control level (70%) restored web and capture area. However, this was achieved by laying down capture meshes at larger distances, rather than returning to initial mesh numbers. Silk supply also had a strong effect. Webs built in unnaturally rapid succession by the same spider (4 in 24 h when 1 is the norm) became sequentially smaller, had fewer radii, shorter capture spirals, and were wider meshed.

Adaptation, Physiological↗
PubMed1997

Cell salvage auto transfusion in total knee replacement surgery.

We conducted a prospective, randomized study to assess the impact of cell salvage, auto transfusion on the requirements for allogeneic blood for patients undergoing a total knee replacement (TKR). One hundred consecutive TKR patients were randomly allocated to receive either autologous blood (using cell salvage) or an allogeneic blood transfusion as necessary. Patients allocated to the autologous group were rescued with allogeneic blood if the postoperative haemoglobin fell below 9 g dL-1. Forty-two (84%) of 50 patients in the autologous group required no supplementary blood transfusion. Forty (80%) of 50 patients allocated to receive allogeneic blood required transfusion. There were no detrimental effects of autologous blood transfusion. We conclude that autologous blood transfusion, using the cell saver system, is a safe and effective method of reducing the need for allogeneic blood transfusion and, in doing so, reduces the risk of transmission of infections associated with allogeneic blood transfusion, whilst decreasing demand on precious allogeneic blood reserves.

Aged↗
PubMed1996

Two receptor interaction domains in the corepressor, N-CoR/RIP13, are required for an efficient interaction with Rev-erbA alpha and RVR: physical association is dependent on the E region of the orphan receptors.

Rev-erbA alpha and RVR/Rev-erb beta/BD73 are orphan steroid receptors that have no known ligands in the 'classical sense'. These 'orphans' do not activate transcription, but function as dominant transcriptional silencers. The thyroid hormone receptor (TR) and the retinoic acid receptor (RAR) act as transcriptional silencers by binding corepressors (e.g. N-CoR/RIP13 and SMRT/TRAC-2) in the absence of ligands. The molecular basis of repression by orphan receptors, however, remains obscure, and it is unclear whether these corepressors mediate transcriptional silencing by Rev-erbA alpha and RVR. Recently, two new variants of N-CoR have been described, RIP13a and RIP13delta1. The characterisation of these splice variants has identified a second receptor interaction domain (ID-II), in addition to the previously characterised interaction domain (ID-I). This investigation utilised the mammalian two hybrid system and transfection analysis to demonstrate that Rev-erbA alpha and RVR will not efficiently interact with either ID-I or ID-II separately from RIP13a or RIP13delta1. However, they interact efficiently with a domain composed of ID-I and ID-II from RIP13a. Interestingly, the interaction of Rev-erbA alpha and RVR is strongest with ID-I and ID-II from RIP13delta1. Detailed deletion analysis of the orphan receptor interaction with RIP13/N-CoR rigorously demonstrated that the physical association was critically dependent on an intact E region of Rev-erbA alpha and RVR. Over-expression of the corepressor interaction domains (i.e. dominant negative forms of N-CoR/RIP13) could alleviate orphan receptor-mediated repression of transactivation by GALVP16. This demonstrated that these regions could function as anti-repressors. In conclusion, these data from two independent approaches demonstrate that repression by Rev-erbA alpha and RVR is mediated by an interaction of ID-I and ID-II of N-CoR, RIP13a and delta1 with the putative ligand binding domain of the orphan receptors.

DNA-Binding Proteins↗
PubMed1996

Transcriptional repression by the orphan steroid receptor RVR/Rev-erb beta is dependent on the signature motif and helix 5 in the E region: functional evidence for a biological role of RVR in myogenesis.

RVR/Rev-erb beta/BD73 is an orphan steroid receptor that has no known ligand in the "classical' sense. RVR binds as a monomer to an element which consists of an A/T-rich sequence upstream of the consensus hexameric half-site. However, RVR does not activate transcription and blocks transactivation of this element by ROR/RZR. The mechanism of RVR action remains obscure, hence we used the GAL4 hybrid system to identify and characterize an active transcriptional silencer in the ligand binding domain (LBD) of RVR. Rigorous deletion and mutational analysis demonstrated that this repressor domain is encoded by amino acids 416-449 of RVR. Furthermore, we demonstrated that efficient repression is dependent on the so-called LBD-specific signature motif, (F/W)AKxxxxFxxLxxxDQxxLL (which spans loop3-4 and helix 4) and helix 5 (H5; identified in the crystal structures of the steroid receptor LBDs). Although RVR is expressed in many adult tissues, including skeletal muscle, and during embryogenesis, its physiological function in differentiation and mammalian development remains unknown. Since other 'orphans', e.g. COUP-TF II and Rev-erbA alpha, have been demonstrated to regulate muscle and adipocyte differentiation, we investigated the expression and functional role of RVR during mouse myogenesis. In C2C12 myogenic cells, RVR mRNA was detected in proliferating myoblasts and was suppressed when the cells were induced to differentiate into post-mitotic, multinucleated myotubes by serum withdrawal. This decrease in RVR mRNA correlated with the appearance of muscle-specific markers (e.g. myogenin mRNA). RVR 'loss of function' studies by constitutive over-expression of a dominant negative RVR delta E resulted in increased levels of p21Cip1/Waf1 and myogenin mRNAs after serum withdrawal. Time course studies indicated that expression of RVR delta E mRNA results in the precocious induction and accumulation of myogenin and p21 mRNAs after serum withdrawal. In addition, we demonstrated that over-expression of the COUP-TF II and Rev-erbA alpha receptors in C2C12 cells completely blocked induction of p21 mRNA after serum withdrawal. In conclusion, our studies identified a potent transcriptional repression domain in RVR, characterized critical amino acids within the silencing region and provide evidence for the physiological role of RVR during myogenesis.

Amino Acid Sequence↗
PubMed1996

Transcriptional repression by Rev-erbA alpha is dependent on the signature motif and helix 5 in the ligand binding domain: silencing does not involve an interaction with N-CoR.

Rev-erbA alpha is an orphan nuclear receptor that functions as a dominant transcriptional repressor. Tissue culture and in situ hybridisation studies indicated that Rev-erbA alpha plays an important role in mammalian differentiation and development. Previous studies have localised the silencing domain of Rev-erbA alpha to the D/E region of the orphan receptor. This study utilised the GAL4 hybrid system to demonstrate that efficient repression is mediated by 34 amino acids (aa) between aa 455 and 488 in the E region of the receptor. This domain contains the ligand binding domain (LBD)-signature motif [(F/W)AKxxxxFxxLxxxDQxxLL] and a region that, according to the recently published crystal structures of steroid receptors, would be predicted to form helix 5 of the canonical LBD structure. Fine deletions and site-specific mutagenesis indicated that both the LBD signature motif and helix 5 were necessary for efficient silencing. Utilising mammalian two hybrid technology, we have also demonstrated that Rev-erbA alpha does not associate with the interaction domain (aa 2218-2451) of the nuclear receptor corepressor, N-CoR, that is known to interact with the thyroid hormone and retinoic acid receptors. This suggested that transcriptional repression by Rev-erbA alpha is not mediated through an interaction with N-CoR. In conclusion, we have identified and characterised the minimal domain of Rev-erbA alpha, that mediates transcriptional repression by this orphan receptor.

Amino Acid Sequence↗
PubMed1995

Identification of a regulatory function for an orphan receptor in muscle: COUP-TF II affects the expression of the myoD gene family during myogenesis.

COUP-TF II is an 'orphan steroid receptor' that binds a wide variety of AGGTCA repeats and represses thyroid hormone (T3) and retinoid dependent trans-activation; however, very little is known of its functional and/or developmental role during mammalian cell differentiation. T3 and retinoids have been demonstrated to promote terminal muscle differentiation via activation of the muscle specific myoD gene family (myoD, myogenin, myf-5 and MRF-4). The myoD gene family can direct the fate of mesodermal cell lineages, repress proliferation, activate differentiation and the contractile phenotype. Hence, we investigated the expression and functional role of COUP-TF II during muscle differentiation. Proliferating C2C12 myoblasts expressed COUP-TF II mRNA which was repressed when cells were induced to differentiate into post-mitotic multinucleated myotubes by serum withdrawal. Concomitant with the decrease of COUP-TF II mRNA was the appearance of muscle specific mRNAs (e.g. myogenin, alpha-actin). We show that Escherichia coli expressed full length and truncated COUP-TF II bound in a sequence specific manner to the T3 response elements (TREs) in the myoD and myogenin regulatory HLH genes [Olson (1992) Dev. Biol. 154, 261-272]; and the TRE in the skeletal alpha-actin contractile protein gene. COUP-TF II diminished the homodimeric binding of the thyroid hormone receptor and the heterodimeric binding of thyroid hormone and retinoid X receptor complexes to these TREs. Constitutive over-expression of COUP-TF II cDNA in mouse C2C12 myogenic cells suppressed the levels of myoD mRNA and blocked the induction of myogenin mRNA, whereas constitutive expression of anti-sense COUP-TF II cDNA significantly increased the steady state levels of myoD mRNA and hyper-induced myogenin mRNA. These studies demonstrate for the first time (i) that COUP-TF II, functions as a physiologically relevant antagonistic regulator of myogenesis via direct effects on the myoD gene family and (ii) direct evidence for the developmental role of COUP-TF II during mammalian cell differentiation.

Actins↗
PubMed1995

Regulation of vertebrate muscle differentiation by thyroid hormone: the role of the myoD gene family.

Skeletal myoblasts have their origin early in embryogenesis within specific somites. Determined myoblasts are committed to a myogenic fate; however, they only differentiate and express a muscle-specific phenotype after they have received the appropriate environmental signals. Once proliferating myoblasts enter the differentiation programme they withdraw from the cell cycle and form post-mitotic multinucleated myofibres (myogenesis); this transformation is accompanied by muscle-specific gene expression. Muscle development is associated with complex and diverse protein isoform transitions, generated by differential gene expression and mRNA splicing. The myofibres are in a state of dynamic adaptation in response to hormones, mechanical activity and motor innervation, which modulate differential gene expression and splicing during this functional acclimatisation. This review will focus on the profound effects of thyroid hormone on skeletal muscle, which produce alterations in gene and isoform expression, biochemical properties and morphological features that precipitate in modified contractile/mechanical characteristics. Insight into the molecular events that control these events was provided by the recent characterisation of the MyoD gene family, which encodes helix-loop-helix proteins; these activate muscle-specific transcription and serve as targets for a variety of physiological stimuli. The current hypothesis on hormonal regulation of myogenesis is that thyroid hormones (1) directly regulate the myoD and contractile protein gene families, and (2) induce thyroid hormone receptor-transcription factor interactions critical to gene expression.

Animals↗
PubMed1995

Effects of carbohydrate supplementation during intense training on dietary patterns, psychological status, and performance.

The purpose of this study was to determine the effects of carbohydrate supplementation during intense training on dietary patterns, psychological status, and markers of anaerobic and aerobic performance. Seven members of the U.S. National Field Hockey Team were matched to 7 team counterparts (N = 14). One group was blindly administered a carbohydrate drink containing 1 g.kg-1 of carbohydrate four times daily, while the remaining group blindly ingested a flavored placebo during 7 days of intense training. Subjects underwent pre- and posttraining aerobic and anaerobic assessments, recorded daily diet intake, and were administered the Profile of Mood States (POMS) psychological inventory prior to and following each practice. Results revealed that the carbohydrate-supplemented group had a greater (p < .05) total energy intake, carbohydrate intake, and change (pre vs. post) in time to maximal exhaustion following training while reporting less postpractice psychological fatigue. However, no significant differences were observed in remaining psychological, physiological, or performance-related variables.

Adult↗
PubMed1995

Constitutive expression of the orphan receptor, Rev-erbA alpha, inhibits muscle differentiation and abrogates the expression of the myoD gene family.

Rev-erbA alpha is an orphan steroid receptor that is expressed in skeletal muscle. Rev-erbA alpha binds to single/tandem copies of an AGGTCA motif, is transcribed on the noncoding strand of the c-erbA- alpha gene locus, and is postulated to modulate the thyroid hormone (T3) response. T3 induces terminal muscle differentiation and regulates fiber type composition via direct activation of the muscle-specific myoD gene family (e.g. myoD, myogenin). The myoD gene family can direct the fate of mesodermal cell lineages and activate muscle differentiation. Hence we investigated the expression and physiological role of Rev-erbA alpha during myogenesis. We observed abundant levels of Rev-erbA alpha mRNA in dividing C2C12 myoblasts, which were suppressed when the cells differentiated into postmitotic multinucleated myotubes. This decrease in Rev-erbA alpha mRNA correlated with the appearance of muscle-specific mRNAs (e.g. myogenin and alpha-actin). Constitutive overexpression of full length Rev-erbA alpha cDNA in the myogenic cells completely abolished differentiation, suppressed myoD mRNA levels, and abrogated the induction of myogenin mRNA. We then demonstrated that 1) GAL4-REV-erbA alpha chimeras that contain the 'AB' region and lack the 'E' region activated transcription of GAL4 response elements in the presence of 8-Br-cAMP and 2) the ligand-binding domain (LBD) contains an active transcriptional silencer. Overexpression of Rev-erbA alpha (delta AB) in myogenic cells had no impact on the ability of these cells to morphologically or biochemically differentiate. Furthermore, this orphan receptor 1) down-regulated thyroid hormone receptor (TR)/T3 mediated transcriptional activity from the myogenin promoter and thyroid hormone response element (TRE) an 2) disrupted TR homodimer and TR/retinoid X receptor (RXR) heterodimer formation on a number of TREs found in the myoD gene family. In conclusion, Rev-erbA alpha functions as a negative regulator of myogenesis by targeting the expression of the myoD gene family. The mechanism of action may involve inhibition of functional TR/RXR heterodimer formation on critical TREs and dominant trans-repression of gene expression.

Actins↗
PubMed1995

CINSTIM: the Southampton Cochlear Implant-Neural Network Simulation and Stimulation framework: implementation advances of a new, neural net-based speech-processing concept.

CINSTIM, a powerful experimental CI tool based on a new, neural net-based robust speech-processing concept, has been implemented. The software package provides a user-friendly GUI. The implementation is block-oriented. That provides flexibility and the option of replacing or exchanging particular blocks for later modifications or extensions. With the first successful and promising patient test we have demonstrated the possibility of applying ANNs to CI speech processing (Leisenberg and Southgate, this suppl, section 16).

Cochlear Implants↗
PubMed1994

Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the effects of triiodo-L-thyronine on in vitro myogenesis; the activation of myoD gene expression in the slow twitch fibres and the cascade of myogenic events regulated by thyroid hormone.

Animals↗
PubMed1994

A real-time LPC-based vocal tract area display for voice development.

This article reports the design and implementation of a graphical display that presents an approximation to vocal tract area in real time for voiced vowel articulation. The acoustic signal is digitally sampled by the system. From these data a set of reflection coefficients is derived using linear predictive coding. A matrix of area coefficients is then determined that approximates the vocal tract area of the user. From this information a graphical display is then generated. The complete cycle of analysis and display is repeated at approximately 20 times/s. Synchronised audio and visual sequences can be recorded and used as dynamic targets for articulatory development. Use of the system is illustrated by diagrams of system output for spoken cardinal vowels and for vowels sung in a trained and untrained style.

Equipment Design↗
PubMed1994

The retinoic acid and retinoid X receptors are differentially expressed during myoblast differentiation.

Retinoids (all trans and 9-cis retinoic acid) are pleiotropic regulators of cell fate, and have been shown to regulate the expression of helix loop helix transcription factors (e.g MyoD, myogenin and Myf-5) that control myogenic differentiation. The effects of retinoids are mediated through the ligand dependent retinoic acid receptors (RARs) and retinoid X receptors (RXRs). We have found that the messenger RNA transcripts encoding RAR are repressed during differentiation of C2C12 myoblasts while, conversely, RXR mRNA transcripts are induced in C2C12 myotubes. These results imply that RXRs, play a major regulatory role in differentiated muscle.

Animals↗