PubMed Health⌕ Search

Biomedical subjects

M Downes

Publications and source records attributed to M Downes.

46 records · Page 3Linked to original sources
PubMed1994

Identification of deoxyribonucleic acid sequences that bind retinoid-X receptor-gamma with high affinity.

The retinoid-X receptor (RXR) family (-alpha, -beta and -gamma) forms homodimers that bind to a number of retinoid-X response elements and trans-activate gene expression in a retinoid-dependent manner. Although, the RXRs are known to bind tandem direct repeats (DR) of the hexamer, RGGTCA, separated by 1 nucleotide, it is not known whether these represent the optimal and/or only recognition sequences. We, therefore, used a nonbiased strategy to identify sequences that efficiently bound RXR gamma, an isoform preferentially expressed in cardiac and skeletal muscle tissue. We performed binding site selection with bacterially expressed RXR gamma bound to glutathione-agarose and a pool of random sequences to derive a consensus DNA-binding site for RXR gamma. We analyzed a total of 41 individually selected oligonucleotides and found that RXR gamma bound with high affinity to motifs that were accommodated by the consensus AARGRNCAAAGGTCAA/cR. We observed that the majority of the sequences that formed complexes with RXR gamma in electrophoretic mobility shift analysis were DR-1 motifs; however, DR- motifs separated by 2, 4, and 8 nucleotides and a palindrome-0 motif were also demonstrated to interact with RXR gamma. Mutagenesis of the derived sequences indicated that both RGGTCA motifs were required for high affinity binding to RXR gamma. These derived sequences conferred appropriate 9-cis- and all-trans-retinoic acid (RA) responses to a thymidine kinase promoter. Furthermore, supershift experiments with a RXR antibody verified that these sequences specifically interacted with RXR in nuclear extracts derived from C2C12 muscle cells. In conclusion, this study rigorously defines the range of DR motifs that can recognize RXR and regulate gene expression in a RA-dependent fashion. The derived consensus accommodates retinoid-X response elements that have been identified in a diverse range of genes trans-activated by 9-cis-RA via the RXR family.

Animals↗
PubMed1993

Identification of a thyroid hormone response element in the mouse myogenin gene: characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site.

Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al., Mol. Endocrinol., 6: 1185-1194, 1992). We have identified a T3 response element (TRE) in the mouse myogenin (MM) promoter between nucleotide positions -526 and -494 (5' GTGGTAGGTCTTTAGGGGTCTCATGGGACTGACA 3'). This sequence conferred appropriate hormonal regulation to an enhancerless SV40 promoter. Electrophoretic mobility shift analysis experiments showed that thyroid hormone receptor alpha (TR alpha) and retinoid X receptor alpha (RXR alpha) formed a heterodimeric complex on the MM TRE that was specifically competed by classical TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides, as predicted by the 3-4-5 rule. Electrophoretic mobility shift analysis experiments showed that the myogenin, growth hormone, and myosin heavy chain TREs interacted with an identical nuclear factor(s) in muscle cells that was constitutively expressed during myogenesis. Mutagenesis of the MM TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4-nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion, our data suggest that the MM TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed1993

Characterization of the thyroid hormone response element in the skeletal alpha-actin gene: negative regulation of T3 receptor binding by the retinoid X receptor.

We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophoretic mobility shift assay experiments showed that Escherichia coli expressed and affinity purified TR alpha bound to the skeletal alpha-actin TRE in a sequence specific manner. The alpha-actin TRE bound TR alpha dimers cooperatively. Mutagenesis of the alpha-actin TRE indicated that the core binding motifs and the gap sequences were the most important for efficient binding to TR alpha. The retinoid X receptor alpha (RXR alpha) interacted with the alpha-actin TRE in a sequence specific fashion and formed heterodimeric complexes with TR alpha on the alpha-actin TRE. However, increased levels of RXR alpha decreased the binding of TR alpha to the alpha-actin TRE, in contrast to promoting TR alpha binding to the alpha-myosin heavy chain TRE. Furthermore, the alpha-actin, palindromic, synthetic direct repeat, alpha-myosin heavy chain, and growth hormone TREs interacted with an identical nuclear factor in vitro in muscle cells. In conclusion, our data suggest that the human skeletal alpha-actin TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)

Actins↗
PubMed1991

Evidence that amikacin ototoxicity is related to total perilymph area under the concentration-time curve regardless of concentration.

Previous studies have failed to fully establish whether ototoxicity is related in any way to the levels of an aminoglycoside antibiotic in the perilymph. To study this we exposed guinea pigs to continuously infused amikacin at four different dosing rates under conditions parallel to those used in our previous study which related ototoxicity to total plasma area under the concentration-time curve regardless of the level in plasma. It was found that at all dosing rates, levels in the perilymph and ratios of levels in perilymph/plasma remained constant as the dosing duration increased from nonototoxic to strongly ototoxic. Plasma and perilymph amikacin levels were found to be linear functions of the dosing rate even at ototoxic dosing exposures, and ratios of levels in perilymph/plasma did not differ between dosing rates. The total perilymph area under the concentration-time curve was not different between dosing rates either for a total dose associated with threshold ototoxicity or for one associated with severe ototoxicity. The results suggest that amikacin ototoxicity is related to the integral of the concentration in the perilymph over the total time of amikacin exposure regardless of the level in the perilymph.

Amikacin↗
PubMed1987

Monoclonal antibodies against plant proteins recognise animal intermediate filaments.

Four monoclonal antibodies were raised against polypeptides present in a high-salt detergent-insoluble fraction from cells of Chlamydomonas reinhardtii. Indirect immunofluorescence microscopy of fibroblasts and epithelial cells grown in culture using these plant antibodies revealed staining arrays identical to those obtained with well characterised antibodies to animal intermediate filaments. Immunofluorescence microscopy of Chlamydomonas with these monoclonal antibodies and a monoclonal antibody that recognises all animal intermediate filaments (anti-IFA) gave a diffuse, patchy cytoplasmic staining pattern. Both the plant antibodies and anti-IFA stained interphase onion root tip cells in a diffuse perinuclear pattern. In metaphase through to telophase, the labelling patterns colocalised with those of microtubules. Labelling of the phragmoplast was also detected but not staining of the preprophase band. On Western blots of various animal cell lines and tissues, all the antibodies labelled known intermediate filament proteins. On Western blots of whole Chlamydomonas proteins, all the antibodies labelled a broad band in the 57,000 Mr range, and three antibodies labelled bands around 66,000 and 140,000 Mr but with variable intensities. On Western blots of whole onion root tip proteins, all the antibodies labelled 50,000 Mr (two to three bands) polypeptides and a diffuse band around 60,000 Mr and three of the antibodies also labelled several polypeptides in the 90,000-200,000 Mr range. The consistent labelling of these different bands by several different monoclonal antibodies recognising animal intermediate filaments makes these polypeptides putative plant intermediate filament proteins.

Antibody Specificity↗
PubMedDate not supplied

Injection-associated pain in femoral arteriography: a European multicenter study comparing safety, tolerability, and efficacy of iodixanol and iopromide.

PURPOSE: To evaluate injection-associated pain, safety, and efficacy with the isotonic contrast medium iodixanol (Visipaque 270 mg I/ml) compared with iopromide (Ultravist 300 mg I/ml) in femoral arteriography. METHODS: A multicenter, double-blind, randomized, parallel-group clinical investigation was carried out in 54 hospitals in Europe. Of the patients evaluated, 1225 received iodixanol and 1227 iopromide in conventional and/or digital subtraction angiography. RESULTS: The iodixanol group reported statistically significantly less injection-associated pain (0.9%) than the iopromide group (9.5%) (p << 0.001). Further, 4.1% in the iodixanol group experienced pain and/or severe heat sensation vs 19. 8% in the iopromide group (p << 0.001). In the iodixanol group, 1.8% of the patients experienced contrast-related adverse events vs 2.4% in the iopromide group (p = NS). Overall diagnostic information was optimal for 94.1% in the iodixanol group and 95.3% in the iopromide group (p = NS). CONCLUSIONS: Iodixanol 270 mg I/ml causes significantly less injection-associated pain during femoral arteriography and is as safe and efficacious as iopromide 300 mg I/ml.

Aged↗
PubMedDate not supplied

Transcriptional repression by COUP-TF II is dependent on the C-terminal domain and involves the N-CoR variant, RIP13delta1.

COUP-TF II/ARP-1 is an 'orphan' steroid receptor that inhibits basal transcription, and represses trans-activation by the vitamin D, thyroid hormone and retinoid receptors. The molecular basis of repression by COUP-TF II remains obscure. In this study we utilized the GAL4 hybrid system to demonstrate that COUP-TF II contains sequences within the C-terminal region that encode a dominant transcriptional repressor that inhibits the ability of the potent chimeric transactivator GAL4VP16 to induce transcription. Mammalian two hybrid analysis demonstrated that COUP-TF II did not efficiently interact with either interaction domains I or II from N-CoR and RIP13. However, COUP-TF II efficiently interacts with a region comprised of interaction domains I + II from the corepressor, RIP13delta1. Efficient interaction of the orphan receptor with the corepressor was critically dependent on a large region comprised of the C, D and E domains of COUP-TF II, which correlated with the domain that maximally represses transcription. This investigation suggested that the N-CoR variant, RIP13delta1 interacts with a region of COUP-TF II that functions as a dominant transcriptional repressor.

8-Bromo Cyclic Adenosine Monophosphate↗