PubMed Health⌕ Search

Biomedical subjects

S Yu

Publications and source records attributed to S Yu.

At least 271 records · Page 15Linked to original sources

Conditionally replicating mycobacteriophages: a system for transposon delivery to Mycobacterium tuberculosis.

Transposon mutagenesis provides a direct selection for mutants and is an extremely powerful technique to analyze genetic functions in a variety of prokaryotes. Transposon mutagenesis of Mycobacterium tuberculosis has been limited in part because of the inefficiency of the delivery systems. This report describes the development of conditionally replicating shuttle phasmids from the mycobacteriophages D29 and TM4 that enable efficient delivery of transposons into both fast- and slow-growing mycobacteria. These shuttle phasmids consist of an Escherichia coli cosmid vector containing either a mini-Tn10(kan) or Tn5367 inserted into a nonessential region of the phage genome. Thermosensitive mutations were created in the mycobacteriophage genome that allow replication at 30 degrees C but not at 37 degrees C (TM4) or 38.5 degrees C (D29). Infection of mycobacteria at the nonpermissive temperature results in highly efficient transposon delivery to the entire population of mycobacterial cells. Transposition of mini-Tn10(kan) occurred in a site-specific fashion in M. smegmatis whereas Tn5367 transposed apparently randomly in M. phlei, Bacille Calmette-Guérin (BCG), and M. tuberculosis. Sequence analysis of the M. tuberculosis and BCG chromosomal regions adjacent to Tn5367 insertions, in combination with M. tuberculosis genomic sequence and physical map data, indicates that the transpositions have occurred randomly in diverse genes in every quadrant of the genome. Using this system, it has been readily possible to generate libraries containing thousands of independent mutants of M. phlei, BCG, and M. tuberculosis.

DNA Transposable Elements↗

Simultaneous determination of urinary cystathionine, lanthionine, S-(2-aminoethyl)-L-cysteine and their cyclic compounds using liquid chromatography-mass spectrometry with atmospheric pressure chemical ionization.

A measurement system for cystathionine (Cysta) lanthionine (LT), and S-(2-aminoethyl)-L-cysteine (AEC), and reduced products of their ketimines, perhydro-1,4-thiazepine-3,5-dicarboxylic acid (PHTZDC), 1,4-thiomorpholine-3,5-dicarboxylic acid (TMDA) and 1,4-thiomorpholine-3-carboxylic acid (TMA) in the urine samples of a patient with cystathioninuria and normal human subjects has been developed, using column liquid chromatography-mass spectrometry. The recoveries were about 90-105% for Cysta, LT and AEC, and about 77-87% for PHTZDC, TMDA and TMA after ion-exchange treatment. The concentrations of Cysta and PHTZDC in the urine of a patient with cystathioninuria were much higher compared with those in the urine of normal human subjects. The concentrations of AEC and TMDA were almost the same. LT and TMA could not be detected in the urine samples by this method. This method proved useful for the determination of sulfur-containing amino acids and their cyclic compounds in biological samples.

Alanine↗

Hydroquinone-O,O'-diacetic acid ('Q-linker') as a replacement for succinyl and oxalyl linker arms in solid phase oligonucleotide synthesis.

When hydroquinone-O,Ooffiacetic acid is used as a linker arm in solid phase oligonucleotide synthesis, the time for NH4OH cleavage of oligodeoxy- or oligoribonucleotides is reduced to only 2 min. This allows increased productivity on automated DNA synthesizers without requiring any other modifications to existing reagents or synthesis and deprotection methods. The Q-linker may also be rapidly cleaved by milder reagents such as 5% NH4OH, potassium carbonate, anhydrous ammonia, t-butylamine or fluoride ion. However, the Q-linker is sufficiently stable for long-term storage at room temperature without degradation and no loss of material occurs during synthesis. The linker is also reasonably resistant to 20% piperidine/DMF, 0.5 M DBU/pyridine and 1:1 triethylamine/ethanol. The Q-linker can therefore serve as a general replacement for both succinyl and oxalyl linker arms.

Hydroquinones↗

Synthesis of Uniform Ferric Oxide Particles from Deionized Colloids

A modified method was employed to prepare monodispersed colloidal particles of ferric (hydrous) oxide. The method contains three steps: (i) preparation of uniform nuclei of ferric hydrous oxide via a so-called instantaneous nucleation method; (ii) purification of the nuclei suspension via dialysis; (iii) aging of the purified nuclei suspension in a reflux reactor at certain pH. Cubic and pseudocubic alpha-Fe2O3 monodisperse particles which are much smaller than the cubic alpha-Fe2O3 particles obtained from the same reactant through a usual method were produced by aging needle like nuclei at a lower pH. A close-packed three-dimensional QDs (quantum dots) superlattice structure 40 nm in edge length with cubic geometry was formed by self-aggregation between spherical amorphous ferric hydrous oxide nuclei 3-5 nm in diameter. The growth processes of the two kind particles were also illustrated. This study showed an approach to prepare smaller particles from aqueous metal salt solutions in relatively higher concentration, and ordered QDs superlattice structure by controlled self-aggregation of QDs in hydrosol.

Journal Article↗

The cloning of a Caenorhabditis elegans guanylyl cyclase and the construction of a ligand-sensitive mammalian/nematode chimeric receptor.

Substantial guanylyl cyclase activity was detected in membrane fractions prepared from Caenorhabditis elegans (100 pmol cGMP/min/mg at 20 degrees C or 500 pmol cGMP/min/mg at 37 degrees C), suggesting the potential existence of orphan cyclase receptors in the nematode. Using degenerate primers, a cDNA clone encoding a putative membrane form of the enzyme (GCY-X1) was obtained. The apparent cyclase was most closely related to the mammalian natriuretic peptide receptor family, and retained cysteine residues conserved within the extracellular domain of the mammalian receptors. Expression of the cDNA in COS-7 cells resulted in low, but detectable guanylyl cyclase activity (about 2-fold above vector alone). The extracellular and protein kinase homology domain of the mammalian receptor (GC-B) for C-type natriuretic peptide (CNP) was fused to the catalytic domain of GCY-X1 and expressed in COS-7 cells to determine whether ligand-dependent regulation would now be obtained. The resulting chimeric protein (GC-BX1) was active, and CNP elevated cGMP in a concentration-dependent manner. Subsequently, a search of the genome data base demonstrated the existence of at least 29 different genes from C. elegans that align closely with the catalytic domain of GCY-X1, and thus an equally large number of different regulatory ligands may exist.

Amino Acid Sequence↗

Efficient purification, characterization and partial amino acid sequencing of two alpha-1,4-glucan lyases from fungi.

alpha-1,4-Glucan lyases from the fungi Morchella costata and M. vulgaris were purified by affinity chromatography on beta-cyclodextrin-sepharose, followed by ion exchange and gel filtration. The purified enzymes produced 1,5-anhydro-D-fructose from glucose oligomers and polymers with alpha-1,4-glucosidic linkages, such as maltose, maltosaccharides, amylopectin, and glycogen. The lyases were basically inactive towards glucans linked through alpha-1,1, alpha-1,3 or alpha-1,6 linkages. For both enzymes the molecular mass was around 121,000 Da as determined by matrix-assisted laser desorption mass spectrometry. The pI for the lyases from M. costata and M. vulgaris was 4.5 and 4.4, respectively. The lyases exhibited an optimal pH range of pH 5.5 to pH 7.5 with maximal activity at pH 6.5. Optimal temperature was between 37 degrees C and 48 degrees C for the two lyases, depending on the substrates. The lyases were examined with 12 inhibitors to starch hydrolases and it was found that they were inhibited by the -SH group blocking agent PCMB and the following sugars and their analogues: glucose, maltitol, maltose, 1-deoxynojirimycin and acarbose. Partial amino acid sequences accounting for about 35% of the lyase polypeptides were determined. In the overlapping region of the sequences, the two lyases showed 91% identity. The two lyases also cross-reacted immunologically.

Amino Acid Sequence↗

Guanylyl cyclase expression in specific sensory neurons: a new family of chemosensory receptors.

A guanylyl cyclase (GC-D) was recently shown to be expressed in a subclass of neurons within the neuroepithelim of the rat, but given that only a single cyclase was discovered, whether it represents an odorant/pheromone receptor as has been suggested for the large family of seven-transmembrane receptors remains unclear. Through cloning and expression of cDNA we now demonstrate that at least 29 genomic or cDNA sequences found in Caenorhabditis elegans represent guanylyl cyclases. Many of the membrane forms retain cysteine residues conserved within the extracellular, ligand-binding domain of known cyclase receptors. Of eight orphan cyclase receptor::GFP (green fluroescence protein) fusion constructs for which signals were obtained, all were expressed in specific sensory neurons. Furthermore, a cyclase/GFP fusion protein (GCY-10/GFP) was principally expressed in the sensory cilium, suggesting these cyclases function as primary chemosensory receptors. For the first time, we also found that chemosensory neurons (ASE), known to be bilaterally symmetric, demonstrate absolute right or left sidedness with respect to the expression of three different cyclases. Thus, the guanylyl cyclases represent an unexpectedly large and new family of sensory neuron receptors that may complement the 7-transmembrane family of odorant/pheromone receptors.

Animals↗

A novel mechanism of virus-virus interactions: bacteriophage P2 Tin protein inhibits phage T4 DNA synthesis by poisoning the T4 single-stranded DNA binding protein, gp32.

P2 prophages have been known to inhibit DNA replication and growth of T-even phages. We show here that this inhibition is due to poisoning of the T-even single-stranded DNA binding protein gp32 by the product of the nonessential P2 tin gene. Synthesis of Tin protein from a gene cloned in a multicopy plasmid is necessary and sufficient to completely prevent de novo DNA replication and growth of wild-type T2 or T4 phage. We isolated more than 20 independent mutants that render T-even phages resistant to poisoning by the P2 Tin protein. In all of these mutants, which we call asp, Asp codon 163 of gene 32 is changed to a Gly or Asn codon. The mutant alleles are recessive; i.e., when wild-type and asp mutants coinfect the same host cells, most DNA replication is poisoned by P2 Tin protein. To explain our results, we propose that the P2 Tin protein interacts with T-even gp32 at position 163 and distorts the helical filament of gene 32 protein on single-stranded DNA. Thereby Tin protein inhibits either assembly or function, or both, of the T4 replisome. The inhibition of late gene expression by P2 Tin protein may be an indirect consequence of inhibition of DNA replication.

Bacteriophage P2↗

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Base Composition↗

Absence of a salt (NaCl) preference or appetite in sodium-replete or depleted kittens.

Many omnivores and herbivores exhibit an appetite for sodium or salt (NaCl) solutions, but a similar sodium appetite has not been demonstrated in carnivores. The choice for or against sodium-adequate diets of sodium-replete and depleted kittens (confirmed by an elevated plasma aldosterone concentration) was examined using a two-bowl choice test. Both bowls contained purified diets, one bowl with one of various levels of sodium (as NaCl) and the other bowl a sodium-deficient diet (0.1 g Na/Kg). Neither sodium-replete nor depleted kittens showed a choice of the diet containing 2 g Na/kg over the deficient diet. Both groups of kittens showed significant aversion to a diet containing 10 g Na/kg diet, with no change in total food intake. Kittens previously exposed to a diet containing 10 g Na/kg diet appeared to have a learned aversion to sodium in subsequent choice tests. We conclude that kittens do not possess an innate sodium appetite and that a sodium appetite is not induced in sodium-depleted kittens.

Animals↗

Thymocyte progenitors and T cell development in aging.

Dysfunction of T lymphocytes in aging has been causally related to a gradual loss of the thymic microenvironmental function. However, in view of the fact that T cells are generated from bone marrow-derived stem cells that settle in the thymus, we have investigated the possibility that aging effects on the bone marrow have an impact on T cell development. Our approach was based on seeding of bone marrow cells, from young and old mice, onto lymphoid-depleted fetal thymus explants, and examining the patterns of T lymphocyte development under organ culture conditions. The results indicate multifactorial effects of aging, on pre-thymic and intra-thymic development processes, as well as on feedback regulation by mature T cells.

Aging↗

'Hepatoma-specific' alphafetoprotein may permit preclinical diagnosis of malignant change in patients with chronic liver disease.

The only hope for effective treatment of hepatocellular carcinoma (HCC or 'hepatoma') lies in early diagnosis. Measurement of the serum alphafetoprotein (AFP) level is potentially a useful screening test. When grossly raised, it is almost diagnostic of HCC. However, modestly elevated levels may also arise in patients with benign chronic liver disease, and this markedly decreases the test's specificity and hence its clinical value. In 582 consecutive attendees at an outpatient clinic for people with chronic liver disease, a single blood sample was taken for analysis of 'total' AFP and the 'hepatoma-specific' AFP isoform. Using ultrasonography as the primary screening method, patients with AFP levels > or = 50 ng ml-1 were followed up throughout the study or until HCC was diagnosed on the basis of conventionally defined criteria. On entry into the study, 53 patients had an AFP concentration > = or 50 ng ml-1 and the 'hepatoma-specific' AFP isoform was detected in 26 of these. During an 18-month follow-up period, a diagnosis of HCC was established by conventional methods in 19 (17 'definite' and two 'probable') of these 26 patients. In only two cases was there ultrasound evidence of tumour development at the time AFP was first found to be elevated; in the remainder a diagnosis of HCC, based on ultrasound screening, was established at a median time of 3.6 months (range 1-18 months) after entry into the study. Among those 27 without the 'hepatoma-specific' isoform, one developed a 'definite' HCC and two developed 'probable' tumours. With the application of 'hepatoma-specific' AFP, the positive predictive value of the test was 73.1%, compared with only 41.5% using the conventional 'total' AFP test. Application of this test for the 'hepatoma-specific' AFP markedly increases the positive predictive value of AFP and, in some cases, permits the presence of tumour to be inferred before it could be detected by routine ultrasound examination.

Carcinoma, Hepatocellular↗

Genetic heterogeneity in familial acute myelogenous leukemia: evidence for a second locus at chromosome 16q21-23.2.

The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D16S289. In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The "repeat expansion detection" method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.

Chromosome Mapping↗

Individual fatty acid effects on plasma lipids and lipoproteins: human studies.

The purpose of this review is to summarize our current understanding of the cholesterolemic effects of individual fatty acids. Although historically there has been great interest in the fatty acid classes, it has been only recently that emphasis has shifted to individual fatty acids. Consequently, and in conjunction with the methodologic challenges inherent in studying individual fatty acids, our database is relatively modest. Nonetheless, it is clear that saturated fatty acids are hypercholesterolemic and that unsaturated fatty acids elicit a hypocholesterolemic effect compared with saturated fatty acids. The question at hand is, What are the relative cholesterolemic effects of the major saturated and unsaturated fatty acids in the diet? On the basis of a limited number of well-controlled studies, it appears that myristic acid is the most potent saturated fatty acid. Of the saturated fatty acids, stearic acid is uniquely different in that it appears to be a neutral fatty acid. Monounsaturated fatty acids appear to exert a neutral effect or to be mildly hypocholesterolemic. trans Fatty acids elicit effects that are intermediate to those of the hypercholesterolemic saturated fatty acids and the cis-monounsaturated and cis-polyunsaturated fatty acids. Polyunsaturated fatty acids elicit the most potent hypocholesterolemic effects. Studies are needed to establish the potency with which each fatty acid affects plasma total and lipoprotein cholesterol concentrations as well as the mechanisms that account for their markedly different effects. This information will be useful in making dietary recommendations for individual fatty acids that may further reduce risk of chronic diseases in the United States.

Cholesterol, LDL↗

The minimum sodium requirement of growing kittens defined on the basis of plasma aldosterone concentration.

The minimum sodium requirement of growing kittens was measured using a 6 x 6 Latin square design. Twelve specific-pathogen-free short-hair growing kittens (six males, six females) were fed casein and lactalbumin-based purified diets supplemented with various levels of sodium (NaCI). Using six growing kittens (four males, two females), a sodium depletion and repletion study was conducted to define the variables associated with sodium deficiency. Sodium-deficient kittens exhibited anorexia, impaired growth, polydypsia, polyuria, hemoconcentration, reduced urinary sodium output and specific gravity, and elevated aldosterone concentration in plasma and output in urine. Plasma sodium concentration was not affected by dietary sodium intake. Urinary sodium output was positively related to (r = 0.818, P < 0.001), but fecal sodium loss was independent of sodium intake. These results suggest that sodium balance in kittens is essentially regulated by renal excretion. The recommended minimum sodium requirement of kittens for growth is 1.6 g Na/kg diet (energy density, 22 kJ ME/g diet), or 0.07 mg Na/kJ ME, or 34 mg Na x kg body wt(-1) x d(-1). A sodium requirement of adult cats for maintenance was estimated to be 21 mg Na x kg body wt(-1) x d(-1). These requirements are considerably greater than those recommended by the National Research Council in 1986.

Aldosterone↗

Localisation of a 10q breakpoint within the PAX2 gene in a patient with a de novo t(10;13) translocation and optic nerve coloboma-renal disease.

We describe a 5 year old boy with a de novo t(10;13) translocation and optic nerve coloboma-renal disease (ONCR). On the basis of GTG banding analysis of prometaphase chromosomes, the patient's karyotype was interpreted as either 46,XY,t(10;13)(q24.3;q12.3) or t(10;13) (q25.2;q14.1). Fluorescence in situ hybridisation (FISH) studies using a YAC clone containing the PAX2 gene and YAC clones adjoining FRA10B at 10q25.2 showed that the 10q breakpoint had occurred just within the PAX2 gene and was proximal to FRA10B. These FISH results suggest that the translocation causes a disruption of the PAX2 gene and leads to ONCR, in agreement with the recent reports of PAX2 mutations in two unrelated families with ONCR. Furthermore, we refined the regional mapping of the human PAX2 gene to the junction of bands 10q24.3 and 10q25.1.

Child, Preschool↗