PubMed Health⌕ Search

Biomedical subjects

Sylvain Ladame

Publications and source records attributed to Sylvain Ladame.

16 recordsLinked to original sources
PubMed2006

Oxazole-based peptide macrocycles: a new class of G-quadruplex binding ligands.

Herein we report on the synthesis and DNA binding properties of a new class of water soluble oxazole-based peptide macrocycles that bind selectively to quadruplex DNA, with no detectable binding to duplex DNA. We have recently identified one quadruplex in the proto-oncogene c-kit that is suspected to act as a regulatory element for the expression of the c-kit gene. Here we provide the first example of a ligand binding to and stabilizing the c-kit quadruplex. Moreover, we show that these macrocycles show a preference for the c-kit quadruplex as compared to the human telomeric quadruplex.

Base Sequence↗
PubMed2006

Discovery of G-quadruplex stabilizing ligands through direct ELISA of a one-bead-one-compound library.

We describe the identification of small-molecule G-quadruplex ligands using a direct ELISA screen of a one-bead-one-compound library of unnatural polyamides displayed on a branched linker with a biotin tag. This general purpose parallel screen for small molecule-oligonucleotide interactions was validated by surface plasmon resonance and ELISA of resynthesized compounds. Linear polyamides displayed similar rankings in their affinity for quadruplex as their branched counterparts. Quadruplex affinity as judged by these surface based techniques was a useful predictor of the ability of the ligands to stabilize the quadruplex to thermal unfolding in solution.

Combinatorial Chemistry Techniques↗
PubMed2006

Investigating a quadruplex-ligand interaction by unfolding kinetics.

We have investigated the interaction of the intramolecular human telomeric DNA G-quadruplex with a hemicyanine-peptide ligand, by studying the rate of quadruplex opening with a complementary DNA oligonucleotide. By employing a minimal kinetic model, the relationship between the observed rate of quadruplex opening and the ligand concentration has enabled estimation of the dissociation constant. A van't Hoff analysis revealed the enthalpy and entropy changes of binding to be -77 +/- 22 kJ mol(-1) and -163 +/- 75 J mol(-1) K(-1), respectively. Arrhenius analyses of the rate constants of opening free and bound quadruplex gave activation energies of 118 +/- 2 and 98 +/- 10 kJ mol(-1), respectively. These results indicate that the presence of the ligand has only a small effect on the activation energy, suggesting that the unbinding of the ligand occurs after the transition state for quadruplex unfolding.

DNA↗
PubMed2006

Synthesis and G-quadruplex binding studies of new 4-N-methylpyridinium porphyrins.

A series of cationic porphyrins carrying 1-3 meso-N-pyridinium groups has been synthesised, and their binding to G-quadruplex DNA has been explored by surface plasmon resonance (SPR) and circular dichroism spectroscopy. Two trans substituents appear to be sufficient for tight binding; preferential binding to the anti-parallel intramolecular human telomeric DNA was observed for the A2trans and A3 porphyrins. The A2trans is able to induce the formation of an anti-parallel G-quadruplex in a K+ free solution, mimicking the effect of a molecular chaperone.

Circular Dichroism↗
PubMed2006

A conserved quadruplex motif located in a transcription activation site of the human c-kit oncogene.

The c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its therapeutic inhibition by small molecules such as imatinib is clinically validated. We identified a putative quadruplex forming 21-nucleotide sequence upstream of the c-kit transcription initiation site (c-kit21), on the G-rich strand, which occupies a site required for core promoter activity. Here, we show by nuclear magnetic resonance (NMR), circular dichroism (CD), and ultraviolet (UV) spectroscopic methods that c-kit21 forms quadruplexes under physiological conditions. Mutational analysis of c-kit21 has provided insights into its structural polymorphism. In particular, one mutated form appears to form a single quadruplex species that adopts a parallel conformation. The quadruplex-forming sequence shows a high level of sequence conservation across human, mouse, rat, and chimpanzee. The small variation in sequence between the quadruplex in human/chimpanzee as compared to the rat/mouse was examined more closely by biophysical methods. Despite a variation in the sequence and length of loop 2, the quadruplexes showed both comparable CD spectra, indicative of parallel quadruplexes, and also similar thermal-stability profiles, suggesting conservation of biophysical characteristics. Collectively, the evidence suggests that this quadruplex is a serious target for a detailed functional investigation at the cell-biology level.

Amino Acid Motifs↗
PubMed2006

Exploring the recognition of quadruplex DNA by an engineered Cys2-His2 zinc finger protein.

We have recently described an engineered zinc finger protein (Gq1) that binds with high specificity to the intramolecular G-quadruplex formed by the human telomeric sequence 5'-(GGTTAG)(5)-3', and that inhibits the activity of the enzyme telomerase in vitro. Here we report site-directed mutagenesis, biophysical, and molecular modeling studies that provide new insights into quadruplex recognition by the zinc finger scaffold. We show that any one finger of Gq1 can be replaced with the corresponding finger of Zif268, without significant loss of quadruplex affinity or quadruplex versus duplex discrimination. Replacement of two fingers, with one being finger 2, of Gq1 by Zif268 results in significant impairment of quadruplex recognition and loss of discrimination. Molecular modeling suggests that the zinc fingers of Gq1 can bind to the human parallel-stranded quadruplex structure in a stable arrangement, whereas Zif268-quadruplex models show significantly weaker binding energy. Modeling also suggests that an important role of the key protein finger residues in the Gq1-quadruplex complex is to maintain Gq1 in an optimum conformation for quadruplex recognition.

Cysteine↗
PubMed2005

Putative DNA quadruplex formation within the human c-kit oncogene.

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Base Sequence↗
PubMed2004

Inhibition of human telomerase activity by an engineered zinc finger protein that binds G-quadruplexes.

The G-quadruplex nucleic acid structural motif is a target for designing molecules that could potentially modulate telomere length or have anticancer properties. We have recently described an engineered zinc finger protein (Gq1) that binds with specificity to the intramolecular G-quadruplex formed by the human telomeric sequence 5'-(GGTTAG)(5)-3' (Isalan et al. (2001) Biochemistry 40, 830-836). Here, we report that Gq1 is able to arrest the action of a DNA polymerase on a template-containing telomeric sequence. Inhibition occurs in a concentration-dependent manner, probably by forming a stabilized G-quadruplex.protein complex. Furthermore, Gq1 inhibits the apparent activity of the enzyme telomerase in vitro, with an IC(50) value of 74.3 +/- 11.1 nM. Possible molecular mechanisms of inhibition are discussed, together with the potential for using engineered zinc fingers to interfere with the cellular processes associated with telomere function.

DNA↗
PubMed2004

Tetrapeptides induce selective recognition for G-quadruplexes when conjugated to a DNA-binding platform.

3,6-Bis-peptide acridine and acridone conjugates have been designed and synthesised to selectively interact with G-quadruplex DNA. The ligand properties are peptide sequence dependent, the highest discrimination being obtained with the FRHR tetrapeptide (up to >50-fold specificity). Molecular modeling studies have helped us rationalise the data and suggest that human telomeric quadruplex DNA can readily accommodate tetrapeptides, and furthermore that FRHR contributes to stabilization of the complex by non-bonded interactions within the TTA loop pockets of the quadruplex. These studies indicate that targeting distinct features of a G-quadruplex with hybrid molecules is a promising strategy for discriminating between quadruplex and duplex DNA.

Acridines↗
PubMed2003

Evidence for the two phosphate binding sites of an analogue of the thioacyl intermediate for the Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase-catalyzed reaction, from its crystal structure.

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzes the reversible oxidative phosphorylation of d-glyceraldehyde 3-phosphate (GAP) into d-glycerate 1,3-bisphosphate (1,3-diPG) in the presence of NAD(+) and inorganic phosphate (P(i)). Within the active site, two anion-binding sites were ascribed to the binding of the C3 phosphate of GAP (P(s)) and to the binding of the attacking phosphate ion (P(i)). The role played by these two sites in the catalytic mechanism in connection with the functional role of coenzyme exchange (NADH-NAD(+) shuttle) has been investigated by several studies leading to the C3 phosphate flipping model proposed by Skarzynski et al. [Skarzynski, T., Moody, P. C., and Wonacott, A. J. (1987) J. Mol. Biol. 193, 171-187]. This model has not yet received direct confirmation. To gain further insight into the role of both sites, we synthesized irreversible inhibitors which form with the essential cysteine residue a thioacyl enzyme analogue of the catalytic intermediate. Here we report the refined glycosomal Trypanosoma cruzi GAPDH in complex with a covalently bound GAP analogue at an improved resolution of 2.0-2.5 A. For this holo-thioacyl enzyme complex, a flip-flop movement is clearly characterized, the change from the P(i) to the P(s) binding site being correlated with the coenzyme exchange step: the weaker interaction of the intermediate when bound at the P(s) site with the cofactor allows its release and also the binding of the inorganic phosphate for the next catalytic step. This result gives strong experimental support for the generally accepted flip-flop model of the catalytic mechanism in GAPDH.

Acylation↗
PubMed2003

G-quadruplex-specific peptide-hemicyanine ligands by partial combinatorial selection.

G-quadruplex DNA-specific ligands were generated using a combinatorial selection of tetrapeptides which were then conjugated to a hemicyanine scaffold. The heterocycle enhanced peptide binding affinity by approximately 1000-fold to give ligands with near micromolar affinity and >40-fold discrimination for quadruplex DNA over duplex.

Carbocyanines↗
PubMed2003

Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-d-glyceric acid.

We report here the first crystal structure of a stable isosteric analogue of 1,3-bisphospho-d-glyceric acid (1,3-BPGA) bound to the catalytic domain of Trypanosoma cruzi glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH) in which the two phosphoryl moieties interact with Arg249. This complex possibly illustrates a step of the catalytic process by which Arg249 may induce compression of the product formed, allowing its expulsion from the active site. Structural modifications were introduced into this isosteric analogue and the respective inhibitory effects of the resulting diphosphorylated compounds on T. cruzi and Trypanosoma brucei gGAPDHs were investigated by enzymatic inhibition studies, fluorescence spectroscopy, site-directed mutagenesis, and molecular modelling. Despite the high homology between the two trypanomastid gGAPDHs (> 95%), we have identified specific interactions that could be used to design selective irreversible inhibitors against T. cruzi gGAPDH.

Animals↗
PubMed2002

Solid-phase synthesis of symmetrical 3,6-bispeptide-acridone conjugates.

[reaction: see text] A novel high-yielding method for the solid-phase synthesis of 3,6-bispeptide-acridone conjugates is reported. It involves initial coupling of bifunctionalized acridone to a resin-bound peptide followed by an on-bead site-site reaction to couple the second peptide. This method leads to clean symmetrical bispeptide derivatives and appears to be general. This strategy will enable the generation of a library of 3,6-bispeptide-acridones to be screened for selective binding to telomeric G-quadruplex DNA.

Acridines↗