PubMed Health⌕ Search

Biomedical subjects

U Jaeger

Publications and source records attributed to U Jaeger.

At least 73 records · Page 4Linked to original sources
PubMed1995

[Effect of changed conditions on body height and body weight of preschool children in Jena].

This article reports results of an anthropological investigation on pre-school children from 1994. The body height and weight are presented and compared with results of the Jena Longitudinal Study and results of the investigations of school children which are carried out in Jena in relatively regular intervals since 1880. For the increase of the body weight since 1985/86 changes in the nutritional situation of the people from East-Germany are discussed. Other changes in the living conditions influencing the somatic development are analysed.

Body Height↗
PubMed1994

Autoimmune-thrombocytopenia and SLE in a patient with 5q-anomaly and deletion of the c-fms oncogene.

Autoimmune-thrombocytopenia was the striking feature in a patient with typical clinical symptoms of systemic lupus erythematosus (SLE), complement C4 deficiency, and positive lupus serology. However, myelodysplasia was found in the bone marrow and chromosome analysis revealed a deletion of the long arm of chromosome 5 (5q-anomaly), which was confirmed by a hemizygosity for the c-fms oncogene (CSF-1-receptor) on Southern blot. Autoimmune phenomena reported in conjunction with myelodysplastic syndromes (MDS), e.g., an elevation of antinuclear antibodies, are usually regarded as nonspecific. This case report suggests that SLE can occur in patients with MDS and that a concomitant autoimmune-thrombocytopenia may mask the typical signs of the 5q- syndrome.

Adult↗
PubMed1994

High levels of bcl-2 protein in circulating T lymphocytes, but not B lymphocytes, of patients with systemic lupus erythematosus.

OBJECTIVE: Defective regulation of programmed cell death (apoptosis) may play a role in the development of autoimmune diseases, and the proto-oncogene bcl-2 is involved in the control of apoptosis in immunocompetent cells. We therefore wished to investigate the expression of bcl-2 in the peripheral lymphocytes of patients with systemic lupus erythematosus (SLE), a prototypical autoimmune disease. METHODS: Levels of bcl-2 expression in the lymphocytes of patients with SLE and, for comparison, in the lymphocytes of healthy controls and patients with rheumatoid arthritis (RA), systemic bacterial infections, and chronic B cell lymphocytic leukemia were studied by 2-color cytofluorography and RNA analysis. RESULTS: In SLE patients, a significant proportion of T cells expressed increased amounts of bcl-2 protein. By fluorescence-activated cell sorter analysis, bcl-2--enriched lymphocytes were found in the CD45RO+ as well as in the CD45RO-, and also in the CD4+ and CD8+, lymphocyte subpopulations. Mononuclear cells of patients with SLE showed increased amounts of bcl-2 messenger RNA. An increased percentage of strongly bcl-2 positive peripheral T lymphocytes was found in patients with bacterial infections, but not in those with RA. CONCLUSION: Although the occurrence of circulating T lymphocytes with abnormally high bcl-2 expression is not specific for SLE, it is evidence for a dysregulation of lymphocytic programmed cell death in this autoimmune disease.

Adolescent↗
PubMed1994

[Results of implantation of uncemented porous metal hip prostheses].

72 patients having cementless spongy-metal hip prosthesis were reexamined by clinical and radiological check up two to seven years after implantation (average 43 months). In case of five patients hip prosthesis had to be changed due to loosening (no bony ingrowth n = 2, loosening of acetabular component due to technical faults n = 3). In correlation to clinical results 88% could be considered as excellent or good, 9% acceptable and 3% as inadequate. 10% of the patients complained about thigh pain. The typical radiological bony reactions of the surrounding bone are described. An evaluation of the radiological results can only be done under consideration of the clinical problems involved. In view of the positive results obtained in the recent time the use of spongy-metal hip prosthesis can be recommended for cementless hip joint replacement in case of younger patients. Especially in case of cemented hip joints which have become loose it will be an advantage to use spongy-metal hip prosthesis.

Adult↗
PubMed1994

PML-RAR alpha PCR positivity in the bone marrow of patients with APL precedes haematological relapse by 2-3 months.

We report the results of serial tests in three patients with hyperleucocytotic AML M3 by haematological methods, coagulation assays and PCR analyses following treatment with ATRA and chemotherapy. All three patients became PCR negative in bone marrow and peripheral blood (sensitivity level 1 in 10(5) cells) after one cycle of ATRA + chemotherapy. However, they relapsed haematologically 6-9 months after achieving complete haematological remission. The haematological relapse was preceded by PCR positivity in the bone marrow by 3 months. Platelet counts decreased already during CHR, but dropped below normal levels only at the time of relapse. Coagulation parameters were not helpful for early prediction of relapse. Our results demonstrate that PCR analysis in the bone marrow is the best way to monitor patients with APL. However, in hyperleucocytotic patients, PCR negativity does not seem to indicate long-term remission.

Base Sequence↗
PubMed1994

Molecular mechanism of the t(14;18)--a model for lymphoid-specific chromosomal translocations.

The chromosomal translocation t(14;18) occurs during early B-cell development and juxtaposes the immunoglobulin heavy chain locus (IgH) with the bcl-2 oncogene. Several factors contribute to the translocation mechanism: (1) The rearrangement of the chromosome 14 DH and JH translocation partners has typical features of V(D)J-recombinase-mediated joining with N-segment addition. (2) The bcl-2 major (mbr) and minor (mcr) breakpoint regions as well as their IgH reciprocal counterparts contain recombinatorial sequences related to chi or the minisatellite-core which bind at least one common DNA-binding protein (bp45). Similar elements are found at the breakpoints of other lymphoid-specific translocations like the t(11;14), t(2;8) or the t(4;11). (3) Structural analysis of the bcl-2 mbr indicates that this region may adopt alternative DNA-configurations which can promote recombination and is cleaved by an endogenous nuclease present in early B-cells. The present data suggest that V(D)J-recombinase as well as chi/minisatellite-core mediated recombination contribute to the mechanism and make the t(14;18) a model system for lymphoid-specific reciprocal translocations.

Base Sequence↗
PubMed1994

[2- to 7-year results of cement-free and cemented joint replacement in femoral neck fractures and coxarthrosis].

In 43 patients with cementless and 43 patients with cemented hip prosthesis (S+G hip system) a clinical and radiological follow up was performed 2-7 years after total hip replacement. In average the follow up period was 43 or 48 months. We found good or excellent results in 88% after cementless and 95% after cemented fixation. The results after cementless hip replacement were caused by loosening in the early postoperative period in 3 cases and more frequently thigh pain. In conclusion of our results and the expected later results after 10 years follow up we prefer the cementless fixation in patients under 60 years and cemented fixation in the group over 70 years. Patients between 60 and 70 years seems to benefit from a fixation with an cementless acetabular component and an cemented stem (hybrid prosthesis).

Adult↗
PubMed1994

[Computed tomography in malignant primary soft tissue tumors].

The results of CT examinations in 36 patients suffering from histologically confirmed malignant primary tumours of the soft tissues are presented (6 rhabdomyosarcomas, 4 leiomyosarcomas, 6 liposarcomas, 4 malignant schwannomas, 5 malignant fibrous histiocytomas, 4 malignant haemangiopericytomas, 3 angiosarcomas, 1 fibrosarcoma, 1 renal sarcoma, 2 malignant mesenchymal tumours without histologically clear classification). The CT image alone will not yield information on the type of tumour or on the tumour status. However, CT continues to rank in the diagnosis of tumours of the soft tissues and is even superior to MR especially in the identification of gas accumulations due to infection in a tumour of the soft tissues that is otherwise unclear. Comparing the literature conclude that MR is now the imaging method of choice in the diagnosis of soft tissue tumours.

Adolescent↗
PubMed1994

Guanine-rich (GGNNGG) elements at chromosomal breakpoints interact with a loop-forming, single-stranded DNA-binding protein.

Proto-oncogene-activation is frequently preceded by chromosomal translocations. Several models suggest that DNA single-strands and loops may serve as intermediates in the process of illegitimate recombination. Guanine-rich, repetitive elements are preferred sites of chromosomal exchange and can undergo conformational changes which result in the generation of single-stranded DNA. Here we describe a single-stranded DNA-binding protein which binds specifically to guanine-rich elements at the breakpoints of human reciprocal translocations, including the t(14;18), t(2;8), t(9;22), t(15;17) and t(4;11) in leukemia and lymphoma. The primitive binding consensus consists of two guanine-residues on either side separated by a spacer of at least two nucleotides (GGN-NGG). Binding activity is unaltered by a spacer length of up to 46 nucleotides. These data suggest that the protein has the unique ability to form or stabilize DNA-loops and may thus play a general role in recombination.

Base Sequence↗
PubMed1993

Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein.

The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.

B-Lymphocytes↗
PubMed1993

Transient lupus anticoagulant associated with hypoprothrombinemia and factor XII deficiency following adenovirus infection.

A potent lupus anticoagulant (LA) was detected in four children, 1 week after the clinical onset of an adenovirus infection. The adenovirus infection was documented by direct virus detection in the stool of one patient and serologically in the others. None of the children had elevated titers of IgM- and only one of IgG-anticardiolipin antibodies (ACA). All patients had a marked reduction of prothrombin activity as well as antigen. Prothrombin-antibody complexes were demonstrated in the patients' plasma or mixtures of patient and normal plasma. Factor XII activity was moderately reduced in three of the patients. All coagulation abnormalities returned to normal within 4-12 weeks. Localized bleeding was observed in two cases, but there was no generalized bleeding tendency or evidence of thrombosis.

Adenoviridae Infections↗
PubMed1993

[Development of thromboses in hip joint endoprostheses. A study with color-coded duplex ultrasound].

After 102 hip replacements in a surgical technique that avoids bone-marrow intravasation as much as possible, color-coded duplex sonography revealed thigh thrombi in only 4 cases without any signs of thrombosis. This rate is lower than that found in all other comparable studies. The investigations stress the role of bone-marrow intravasation in the induction of deep vein thrombosis in hip replacement. With an optimal surgical technique, thigh thrombi can be greatly reduced in hip replacements, which have a higher rate than all other operations.

Aged↗
PubMed1992

[Distribution of the incidence of sonographically detected focal liver changes in patients with colorectal cancer].

Aim of the following study was to investigate how often liver metastases are detected in oncologic patients as compared to other focal liver lesions. Preoperative sonographic examinations of 209 patients with proven colonic or rectal cancer were studied. In 19 liver metastases were detected, which in only one patient were homogeneous echogenic. Liver cysts were found in 17, hemangiomas in 15 patients, all of whom where solitary lesions and between 6 and 25 mm in diameter. Focal fatty infiltration was diagnosed in 14 patients. In conclusion, a sonographically detected liver lesion, which is homogeneous echogenic and less than 20 mm in size, is most likely to be a hemangioma and should be further investigated, if therapeutically relevant.

Colorectal Neoplasms↗
PubMed1991

[Acute corticosteroid myopathy in patient with asthma].

A patient, treated by mechanical ventilation with pancuronium or atracurium and with intravenously administered corticosteroid for status asthmaticus, presented with rhabdomyolysis (severe amyotrophy and marked of creatine kinase activity) and acute flacid and areflexic quadriplegia, involving the proximal and distal muscles but sparing the cephalic musculature. After review of the investigations (biochemistry, electromyogram, muscle biopsy), the diagnostic of acute corticosteroid myopathy following status asthmaticus was suggested, and a pancuronium neuromuscular complication or a critically ill polyneuropathy excluded. The non-inflammatory rhabdomyolysis concerned all the fiber types. Predominantly distal weakness resolved six months after the insult, in spite of the laboratory recurrence of the rhabdomyolysis at the time of a new status asthmaticus briefly treated with corticosteroid.

Acute Disease↗
PubMed1990

[Dental age in dependence on the stage of selected physiological developmental parameters].

Result from a cross-sectional study on schoolchildren (aged 7 to 15 years) from Jena will be represented the intercorrelations between the dental age and choice developmental criteria. Moreover we investigated the influence of a social factor (rank among siblings of the family) to the level of development of the teeth. It can be shown that the dental age is relatively independent of the level of physical development of children, but there is a rather strictly correlation with chronological age. It makes demands for an interdisciplinary investigation, to get differentiate insights into ontogenetical processes of growth and development especially in children and youth.

Adolescent↗
PubMed1990

[Results of the anthropologic studies of school children in Jena between 1880 and 1985].

The present report is based on the results from anthropological examinations on schoolchildren, which have been carried out in Jena since 1880. The introduction to the paper gives a survey on the goals of these inquiries, followed by remarks on secular changes in selected measurements of the body (body height, body weight, chest circumference). Besides the extent of the changes in these features, the anticipation of the pubertal growth period and--by means of the relation of body height to chest circumference--a becoming slimmer of today's population of schoolchildren is documented. The comparison of the findings of 1975 and 1985 shows that, regarding the features mentioned, the acceleration in the Jena probands (although in part with reduced intensity) has lasted up to the present time.

Adolescent↗
PubMed1990

[The current status of secular acceleration].

The present paper is based upon the results of anthropological examinations of Jena schoolchildren. It gives a statement on the extent and the present level of secular changes in selected characteristics. Over long periods of time a becoming slimmer of today's population of Jena schoolchildren is documented. The secular acceleration in Jena probands has lasted up to the present time (although in part with reduced intensity).

Adolescent↗