PubMed Health⌕ Search

Biomedical subjects

V A Erdmann

Publications and source records attributed to V A Erdmann.

At least 145 records · Page 8Linked to original sources
PubMed1984

Reconstitution of 50 S ribosomal subunits from Bacillus stearothermophilus with 5 S RNA from spinach chloroplasts and low-Mr RNA from mitochondria of Locusta migratoria and bovine liver.

Reconstitution experiments with 50 S ribosomal subunits from Bacillus stearothermophilus demonstrate that spinach chloroplast 5 S rRNA can be incorporated into the bacterial ribosome and yield biologically active particles, thereby establishing the eubacterial nature of chloroplast 5 S rRNA. In contrast, mitochondria from Locusta migratoria or bovine liver do not appear to contain discrete, low-Mr RNAs, which can replace 5 S rRNA in the functional reconstitution of B. stearothermophilus ribosomes.

Animals↗
PubMed1984

The number of ribosomal RNA genes in Thermus thermophilus HB8.

We have examined the number of rRNA genes in Thermus thermophilus HB8 by hybridization of Bam HI -, Hind III - and Pst I - digests of DNA to 3'- (3 2p) 23S, 16S and 5S rRNAs according to the Southern procedure. The restriction gels gave two radioactive bands with 23S and 5S rRNA. Furthermore, band positions were indistinguishable from one another when 23S and 5S rRNAs were used as probes to Bam HI and Hind III digests, indicating that each band contains sequences corresponding to the 3'-end of 23S and 5S rRNAs. The Pst I digest also gave two radioactive bands with 23S and 5S rRNAs as probes, where one band position was identical, but the other different. The 16S rRNA did hybridize with two fragments, using a Bam HI, as well as a Bam HI - Hind III double digest. The Hind III digest gave one band using 16S rRNA as a probe. It is concluded that the Thermus thermophilus HB8 chromosome carries at least two sets of genes for 23S, 16S and 5S rRNAs.

Base Sequence↗
PubMed1984

The nucleotide sequence of the cytoplasmic 5S rRNA from the horsetail, Equisetum arvense.

Using 3'- and 5'-end labelling sequencing techniques, the following sequence for the cytoplasmic 5S rRNA of the horsetail Equisetum arvense could be determined: (sequence in text). This sequence exhibits all features expected for higher plant cytoplasmic 5S rRNAs, and can be fitted to the secondary structure model for 5S rRNA proposed by De Wachter et al. (15).

Base Sequence↗
PubMed1983

Isolation and characterization of a 7 S RNP particle from mature Xenopus laevis oocytes.

Mature oocytes of Xenopus laevis contain a 7 S RNP particle consisting of two components, ribosomal 5 S RNA and a protein of Mr approximately 45000. The structure of the free 5 S rRNA and the 7 S RNP complex has been studied by diethylpyrocarbonate modification of adenines. A74, A77, A90, A100, A101 and A103 of the 5 S rRNA are protected upon association of the protein.

Animals↗
PubMed1983

Terminal heterogeneity and corrections of the nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8.

The nucleotide sequence of 5S rRNA from an extreme thermophile Thermusthermophilus HB8 has been re-examined and determined as [Formula: see text] The present study could resolve previously ambiguous residues and find two additional residues (G(8 3), C(9 7)), G at position 89 and two terminal heterogeneities which are exactly the same as reported with Thermusaquaticus 5S rRNA.Images

Base Sequence↗
PubMed1983

Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat.

Base Sequence↗
PubMed1983

Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

Base Sequence↗
PubMed1983

Chemical reactivity of E. coli 5S RNA in situ in the 50S ribosomal subunit.

E. coli 50S ribosomal subunits were reacted with monoperphthalic acid under conditions in which non-base paired adenines are modified to their 1-N-oxides. 5S RNA was isolated from such chemically reacted subunits and the two modified adenines were identified as A73 and A99. The modified 5S RNA, when used in reconstitution of 50S subunits, yielded particles with reduced biological activity (50%). The results are discussed with respect to a recently proposed three-dimensional structure for 5S RNA, the interaction of the RNA with proteins E-L5, E-L18 and E-L25 and previously proposed interactions of 5S RNA with tRNA, 16S and 23S ribosomal RNAs.

Adenine↗
PubMed1983

Dynamics of ribosomal RNA structure.

The structural dynamics of ribosomal 5S RNAs have been investigated by probing single strandedness through enzymatic cleavage and chemical modification. This comparative study includes 5S rRNAs from E. coli, B. stearothermophilus, T. thermophilus, H. cutirubrum, spinach chloroplast, spinach cytomplasm, and Artemia salina. The structural studies support a unique tertiary interaction in eubacterial 5S rRNAs, involving nucleotides around positions 43 and 75. In addition long range structural effects are demonstrated in E. coli 5S rRNA due to the conversion of C to U at position 92.

Base Sequence↗
PubMed1983

Chemical modification of 5S and 4.5S rRNAs in situ in spinach chloroplast ribosomes.

Spinach chloroplast ribosomes and 50S subunits were reacted with diethylpyrocarbonate under conditions in which their gross structures can be maintained. 5S and 4.5S rRNAs were isolated from such modified particles and the modified adenine residues of these rRNAs were identified by using gel sequencing method. The accessible sites of 5S rRNA in 50S subunits to the reagent were found to be A15, A40 and A89 and that of 5S rRNA in whole ribosomes was restricted to A89. In the case of 4.5S rRNA, A33 was exclusively modified in ribosomes or 50S subunits.

Chloroplasts↗
PubMed1982

Nucleotide sequence and secondary structure analysis of spinach chloroplast 4.5 S RNA.

The nucleotide sequence of the 4.5 S ribosomal RNA from Spinacia oleracea chloroplast has been determined to be HOAGAGAAGGUCACGGCGAGACGAGCCGUUUAUCAUUAC GAUAGGUGUCAAGUGGAAGUGCAGUGAUGUAUGCAGCUGAGGCAUCCUAACAGACCCACAGACUUGAACOH using rapid gel sequencing techniques. This RNA contains 106 nucleotides including an AGA sequence at the 5'-end not found in other chloroplast 4.5 S RNAs and a seven-nucleotide segment absent in the sequences of wheat and maize 4.5 S RNAs. Except for these differences, the sequence of spinach 4.5 S RNA is highly homologous with those of other species. It shows 95% sequence homology to that of tobacco and 78% homology to those of wheat and maize. The secondary structure was probed using limited ribonuclease T1 and nuclease S1 digestions. The results support the 5'-half of the secondary structure model previously proposed for 4.5 S RNA (Machatt, M. A., Ebel, J.-P., and Branlant, C. (1981) Nucleic Acids Res. 9, 1533-1549) but are inconsistent with the rest of that model. An alternative model for spinach 4.5 S RNA is discussed.

Base Sequence↗
PubMed1982

Binding of spermidine to transfer ribonucleic acid.

The binding of spermidine to yeast tRNAPhe and Escherichia coli tRNAGlu2 at low and high ionic strength was studied by equilibrium dialysis. Once corrected for the expected Donnan effect, the binding at low ionic strength obeys the simple relationship of equivalent binding sites, and cooperative binding of spermidine to tRNA could not be detected. At low ionic strength (0.013 M Na+ ion), tRNAPhe (yeast) has 13.9 +/- 2.3 strong spermidine binding sites per molecule with Kd = 1.39 X 10(-6) M and a few weak spermidine binding sites which were inaccessible to experimentation; tRNAGlu2 (E. coli) has 14.8 +/- 1.6 strong spermidine binding sites and 4.0 +/- 0.1 weak spermidine binding sites with Kd = 1.4 X 10(-6) M and Kd = 1.23 X 10(-4) M, respectively. At high ionic strength (0.12 M monovalent cation) and 0.01 M Mg2+, tRNAPhe (yeast) has approximately 13 strong spermidine binding sites with an apparent Kd = 3.4 X 10(-3) M while the dimeric complex tRNAPhe X tRNAGlu2 has 10.4 +/- 1.2 strong spermidine binding sites per monomer with an apparent Kd = 2.0 X 10(-3) M. In the presence of increasing Na+ ion or K+ ion concentration, spermidine binding data do not fit a model for competitive binding to tRNA by monovalent cations. Rather, analysis of binding data by the Debye-Hückel approximation results in a good fit of experimental data, indicating that monovalent cations form a counterion atmosphere about tRNA, thus decreasing electrostatic interactions. On the basis of equilibrium binding analyses, it is proposed that the binding of spermidine to tRNA occurs predominantly by electrostatic forces.

Mathematics↗
PubMed1982

Three-dimensional structural model of eubacterial 5S RNA that has functional implications.

Escherichia coli 5S RNA and its specific protein complexes were hydrolyzed with the single-strand-specific nuclease S1. Based on the results, a tertiary structural model for E. coli 5S RNA is proposed in which ribosomal proteins E-L5, E-L18, and E-L25 influence the conformation of the RNA. This may be of significance for ribosomal function. Comparison of the proposed E. coli 5S RNA structure with those of 18 other prokaryotic 5S RNAs led to a generalized eubacterial 5S RNA tertiary structure in which the majority of the conserved nucleotides are in non-base-paired regions and several conserved "looped-out" adenines (in E. coli, adenines -52, -53, -57, -58, and -66) are implied to be important for protein recognition or interaction or both.

Endonucleases↗