PubMed Health⌕ Search

Biomedical subjects

V A Erdmann

Publications and source records attributed to V A Erdmann.

At least 163 records · Page 9Linked to original sources
PubMed1982

The effect of a cytidine-to-uridine transition on the stability of Escherichia coli A19 5-S RNA.

We have been able to isolate several species of 5-S ribosomal RNA from Escherichia coli A19. These molecules were separated on the basis of their differing stabilities during electrophoresis on 12% polyacrylamide gels in 7 M urea. This differing stability is shown, in one case, to be due to a different primary sequence. We have determined the sequence of the least stable of these molecules and have found only one difference to the published sequence of E. coli A19 5-S RNA, namely a uridine in place of a cytidine at position 92. The consequent G x U base pair, formed in a normally highly stable G x C-rich region, is responsible for a drastic reduction in the stability of the molecule. This instability leads to a less constrained, more compact molecule which thus migrates faster in electrophoresis under denaturing conditions. This species of 5-S RNA is shown to make up 30% of the total 5-S RNA in the 50-S ribosomal subunits in this organism. Further structural studies were carried out using S1 nuclease digestion, sodium bisulphite modification and thermal melting analysis. All these methods indicate a 5-S RNA drastically destabilized in parts of its secondary and tertiary structure. Finally, the ability of the variant 5-S RNA to recognize and form a complex with its 50-S subunit binding proteins was examined and found to be impaired.

Cytidine↗
PubMed1981

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8.

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.

Base Sequence↗
PubMed1981

A hydrogen exchange study of Escherichia coli 5S RNA.

Using the tritium Sephadex method, the number of exchangeable protons in E. coli 5S RNA and the kinetics of their exchange reactions have been measured at two different Mg++ concentrations (10(-2) M and 10(-3) M). A quantitative analysis of these results indicates the presence of two classes of protons exchanging with very different rates. The protons of the slow class, not seen in linear molecules of double helical RNA, exchange with a half-time of 0.6 hour and their exchange kinetics are independent of Mg++ concentration. Reduction of the Mg++ concentration from 10(-2) ot 10(-3) M, however, results in a decrease in the number of these exchangeable protons form 26 to 19. Neither the total number, nor the exchange kinetics of the fast protons are affected by this change in Mg++ concentration. Comparison of these results with those previously obtained with tRNA, suggests the presence of a Mg++ dependent tertiary structure in 5S RNA. The number of exchangeable protons obtained from extrapolation of the exchange curves (120 and 126 respectively for 10(-3) and 10(-2) M Mg++ concentration) are compared to the calculated number of exchangeable protons predicted by previous proposed structural models for E.Coli 5S RNA.

Escherichia coli↗
PubMed1981

Determination of base pairing in yeast 5S and 5.8S RNA infrared spectroscopy.

Infrared Spectroscopy was used to determine the numbers of base pairs for yeast 5S RNA and 5.8S RNA. The spectra were recorded at 20 degrees C and 50 degrees C, where tertiary interactions are assumed to be of less importance. It may be concluded that the structure of both RNAs is highly ordered and that there are large contributions of tertiary interactions. The results are compared with data derived from structural models that were proposed in the literature as well as with data previously published for prokaryotic 5S RNAs.

Base Composition↗
PubMed1981

Fluorescence modification of Escherichia coli 5S RNA.

Reaction of 5S RNA with chlorocetaldehyde leads to the conversion of unpaired adenines to the fluorescent 1,N6-etheno-adenine derivatives. Up to 16 of the 23 adenines in free 5S RNA can be modified, the fastest reacting are A29, A34, A57-59. Partial modification of adenines in this area results in a 20% reduction in the efficiency of 5S RNA incorporation into 50S subunits during reconstitution and a 15% reduction in the activity of these subunits in peptide synthesis. Fluorescence from 1,N6-etheno-adenine is quenched in free 5S RNA and is not detectably further influenced by the binding of proteins E-L5, E-L18 and E-L25, nor by the first stage of the two step E. coli 50S subunit reconstitution procedure. However, the fluorescence is further reduced to near zero after the second step of the reconstitution. Thus, 5S RNS free in solution contains 16 unpaired adenines, those in the region between A29 and A59 particularly accessible to modification by chlorocetaldehyde. This portion of the 5S RNA molecule appears to undergo either a conformational change or interacts with other ribosomal components in the last stage of subunit reassembly.

Acetaldehyde↗
PubMed1981

Favored incorporation of tubercidin in poly(adenylic, 7-deazadenylic acids) and their function as messenger ribonucleic acids in protein synthesis.

The following polynucleotides containing the antibiotic tubercidin (Tu; 4-amino-7-beta-D-ribofuranosylpyrrolo-[2,3-d]pyrimidine) were enzymatically synthesized by polymerization of adenosine 5'-diphosphate-tubercidin 5'-diphosphate mixtures with polynucleotide phosphorylase: poly(A2,Tu), poly(A,Tu2), and poly(Tu). The incorporation of the antibiotic was favored by the enzyme. The polymers are compared to poly(adenylic acid) [poly(A)] with respect to their structure, conformation, and ability to direct polylysine synthesis in a ribosome-dependent protein synthesis system. From physical data (thermal melting, NMR, and circular dichroism) it is concluded that tubercidin destabilizes the structure of the polynucleotide chain and that this may be due to an altered polarization of the nucleobases and their enhanced rotation around the N-glycosylic bond. Since there is an apparent correlation between thermal unfolding of the polymers and their ability to mediate polylysine synthesis, it is suggested that partial destacking of the messenger ribonucleic acid favors its binding to the ribosome and/or its ability to enhance codon-anticodon-specific protein synthesis.

Circular Dichroism↗
PubMed1981

Reconstitution of biologically active 50S ribosomal subunits with artificial 5S RNA molecules carrying disturbances in the base pairing within the molecular stalk.

Bacillus stearothermophilus 50S ribosomal subunits were reconstituted in vitro using artificial 5S RNA molecules constructed by combining parts of major and minor type (Raué et al. (1976) Europ. J. Biochem. 68, 169-176) B. licheniformis 5S RNA. The artificial 5S RNA molecules carry defined disturbances (A.C juxtapositions and extra G.U pairs) in the base pairing between the 5'- and 3'-terminal sequences of the molecule (the molecular stalk region). The biological activity of the reconstituted subunits was determined in an E. coli cell-free system programmed with poly-U. The results show that conservation of the base pairing within the molecular stalk is not required for biological activity of 5S RNA. Disturbances of the base pairing within this region do reduce the rate of reconstitution, however. Normal base pairing in the molecular stalk is thus required to ensure efficient ribosome assembly.

Bacillus↗
PubMed1979

Determination of base pairing in Escherichia coli and Bacillus stearothermophilus 5S RNAs by infrared spectroscopy.

The extent of base pairing in Escherichia coli and Bacillus stearothermophilus 5S RNAs was determined by infrared spectroscopy. From the infrared spectra taken at 20 degrees and 52 degrees C it is concluded that E. coli and B. stearothermophlius 5S RNAs possess a large number of base pairs (Table I). Comparison of our results with those previously published using other methods leads to the conclusion that the structures of prokaryotic 5S RNAs involve a large number of tertiary interactions, in which the base pairing is not necessarily solely of the Watson-Crick type.

Base Composition↗
PubMed1978

The synthesis of a photoreactive puromycin analogue and its application for labeling proteins in the 50-S subunit of Escherichia coli ribosomes.

A photoreactive puromycin analogue, 6-dimethylamino-9-[3-(p-azido-L-beta-phenylalanylamino)-3-deoxy-beta-ribofuranosyl] purine, was synthesized. Biological activity was demonstrated by inhibition of the poly (U)-directed phenylalanine-incorporation system and by decomposition of isolated polysomes from Escherichia coli. The 3H-labeled puromycin analogue was covalently attached to the 50-S subunit of isolated 70-S ribosomes from Escherichia coli after irradiation. More than 90% of the radioactivity was bound to the protein fraction. The 70-S proteins were separated by two-dimensional gel electrophoresis. The proteins labeled primarily were those of the 50-S subunit, identified as L6, L13, L18, L22 and L25. On the basis of the affinity label used and supportive data from the literature, it is concluded that these proteins are at the active center of the 50-S particle and probably belong to the region of the ribosomal A site.

Affinity Labels↗
PubMed1978

Identification of Escherichia coli and Bacillus stearothermophilus ribosomal protein binding sites on Escherichia coli 5S RNA.

E coli [32P]-labelled 5S RNA was complexed with E. coli and B. stearothermophilus 50S ribosomal proteins. Limited T1 Rnase digestion of each complex yielded three major fragments which were analysed for their sequences and rebinding of proteins. The primary binding sites for the E. coli binding proteins were determined to be sequences 18 to 57 for E-L5, 58 to 100 for E-L18 and 101 to 116 for E-L25. Rebinding experiments of purified E. coli proteins to the 5S RNA fragments led to the conclusion that E-L5 and E-L25 have secondary binding sites in the section 58 to 100, the primary binding site for E-L18. Since B. stearothermophilus proteins B-L5 and BL22 were found to interact with sequences 18 to 57 to 100 it was established that the thermophile proteins recognize and interact with RNA sequences similar to those of E. coli. Comparison of the E. coli 5S RNA sequence with those of other prokaryotic 5S RNAs reveals that the ribosomal proteins interact with the most conserved sections of the RNA.

Base Sequence↗
PubMed1978

Binding sites of E. coli and B. stearothermophilus ribosomal proteins on B stearothermophilus 5S RNA.

The primary binding sites for Bacillus stearothermophilus proteins B-L5 and B-L22 and the Escherichia coli proteins E-L5, E-L18 and E-L25 on B. stearothermophilus 5S RNA were determined by limited ribonuclease digestion of the corresponding 5S RNA-protein complexes. The results obtained in this study are in agreement with our previous experiments in which the binding sites of E. coli and B. stearothermophilus proteins were determined for E. coli 5S RNA and lead to the conclusion that the proteins interact with the most conserved regions of 5S RNA. A comparison of the results obtained in this study with those of other published experiments suggest that the proposed interaction of nucleotides 16-21 with those of 58-63 is facilitated by protein binding to 5S RNA.

Bacterial Proteins↗