PubMed Health⌕ Search

Biomedical subjects

Z Walter

Publications and source records attributed to Z Walter.

At least 37 records · Page 2Linked to original sources
PubMed1986

Sites of methylation of DNA bases by the action of organophosphorus insecticides in vitro.

Methylation in vitro of DNA by three methyl-14C-labelled organophosphorus insecticides has been studied. The ability of methylbromphenvinphos, methylparathion and malathion to methylate N-7 of guanine in DNA can be expressed as 100:40:15. Among the methylation products, no O6-methylguanine, a known mutagen, was found. Both in the reaction with dsDNA and with ssDNA 7-methyl-guanine was the main methylation product. However, all methyl derivatives of adenine (3-methyladenine, 1-methyladenine and 7-methyladenine) constituted about 40% and 50% of all methylation products in the case of dsDNA and ssDNA, respectively. The only methyl derivative of pyrimidine we have identified was 3-methylcytosine. In the case of dsDNA 3-methylcytosine appeared in small amounts but in the alkylated ssDNA 3-methylcytosine C constituted about 20% of all alkylation products.

Animals↗
PubMed1985

Estimation of the extent of platination and the sites of Pt binding after interaction of cis- and trans-diamminedichloroplatinum(II) with DNA and chromatin.

Differences in the mode of binding of cis- and trans-diamminedichloroplatinum(II) complexes (cis and trans-DDP) with DNA and chromatin were studied with the use of [14C]methylbromphenvinphos as an alkylating agent which attacks the sites in purines bases involved also in the reaction with cis-DDP (Oliński et al., J. Biochem. Biophys. Meth., 7, 171-173, 1983). Methylation of pre-formed DDP-DNA and DDP-chromatin complexes, followed by qualitative and quantitative analysis of the methylation products in DNA hydrolysates, permitted evaluation of the distribution and extent of platination of the bases. No major differences were found between the action of the two DDP isomers on DNA. However, a significant decrease in binding of trans-DDP to adenine moieties was observed when the interaction of cis- and trans-DDP on chromatin was compared.

Animals↗
PubMed1983

Separation of platinated derivatives of nucleic acid bases on Sephadex G10.

dGMP, dAMP, dCMP and dTMP were incubated with cis PDD in a nucleotide/Pt ratio 1:1 for 72 h. Following hydrolysis, Pt derivatives of the bases were separated on Sephadex G10 columns. dGMP, dAMP and dCMP reacted with cis PDD but only dGMP reacted completely. All the nucleotides mentioned above formed adducts with cis PDD with a metal to ligand ratio 1:1. Moreover an ML2 complex was isolated after the reaction of dGMP with cis PDD. These Pt-base(s) complexes were eluted from the columns in separate peaks. UV spectra of the complexes differed from the standard ones. In some peaks, eluted separately from the standards, no Pt was detected. The samples eluted in these peaks had UV spectra different from the standards. They may represent products of base degradation.

Chromatography, Gel↗
PubMed1982

Interaction of zinc ions with DNA-dependent RNA polymerases A, B and C isolated from calf thymus.

Purified DNA-dependent RNA polymerases A, B and C isolated from calf thymus contain a significant amount of zinc. Atomic absorption spectroscopy revealed the presence of 6.7, 5.35 and 2.6--4.1 g-atoms of zinc per mole of polymerase A, B and C, respectively. These enzymes are inhibited by treatment with 1,10-phenanthroline at concentrations varying from 10(-5) to 10(-4) M. However, the addition of zinc ions does not restore fully the activity of 1,10-phenanthroline treated enzymes. Exogenous zinc ions reduce in vitro an overall RNA synthesis catalysed by RNA polymerases from calf thymus. In addition to the sites which bind zinc in a specific and stoichiometric way these enzymes possess other classes of binding sites with high and low affinity. Occupancy by exogenous zinc of these additional binding sites inhibit polymerase activity.

Animals↗
PubMed1982

Characterization of three subclasses of DNA-dependent RNA polymerases C from calf thymus.

DNA-dependent RNA polymerases from calf thymus tissue were solubilized and purified. Among seven chromatographically different forms of RNa polymerases obtained on DEAE-cellulose or DEAE-Sephadex chromatographies three subclasses of enzymes C were found. General enzymatic properties as: a moderate sensitivity to alpha-amanitin, divalent cation requirements, the preference for native DNA, efficient transcription of poly[d(A-T)], were similar to those described for C RNA polymerases from other sources. The molecular structures of CI, CII and CIII enzymes were indistinguishable; the enzymes were composed of two high molecular polypeptides 158,000 and 138,000 and several smaller subunits 99,000, 80,000, 78,500, 64,500, 52,000, 44,000, 32,000 and 24,000. Transcriptional activities of the chromatographically distinct forms of C polymerases were the same. The C enzymes exhibited striking affinity for homologous native A-T enriched DNA; Km values showed the greater number of binding and initiation sites localized in this template; therefore, A-T pairs are considered to be starter points for the transcription process catalysed by class C RNA polymerases.

Amanitins↗
PubMed1980

Effect of malathion on the genetic material of human lymphocytes stimulated by phytohemagglutinin (PHA).

This paper gives the results of studies on the effects of malathion on human lymphocytes stimulated by PHA, including cell survival, chromosomal aberration and nucleic acid content. Increasing malathion doses (10-70 micrograms/ml) were introduced into cultures of human lymphotyes at different times relative to the time of PHA addition. At a concentration of 10 micrograms/ml, malathion induced an increase in the RNA and DNA fractions in lymphocyte cultures. Higher malathion concentrations (50 and 70 micrograms/ml), especially the dose of 70 micrograms/ml, induced both a significant decrease in the content of RNA and DNA and reduced survival of cultured cells. The insecticide damaged the chromosome structure, but no correlation was revealed between the dose and the level of chromosome aberrations.

Cell Survival↗
PubMed1980

Effect of malathion on nucleic acid synthesis in phytohemagglutinin-stimulated human lymphocytes.

The effect of malathion, an organophosphorus insecticide, on DNA and RNA synthesis was investigated by measuring the rate of incorporation of 3H thymidine and 3H uridine, respectively, into human lymphocytes stimulated by phytohemagglutinin (PHA). Increasing concentrations of malathion, from 10 to 70 micrograms/ml, were added to human lymphocyte cultures at different times in relation to PHA introduction. The lowest applied dose of malathion (10 micrograms/ml) in most cases led to increased incorporation of both 3H thymidine and 3H uridine. Higher concentrations of malathion (30, 50, 70 micrograms/ml) caused a time- and dose-dependent decrease of radioisotope incorporation.

Cells, Cultured↗
PubMed1980

Changes in DNA properties due to treatment with the pesticides malathion and DDVP.

Properties of calf thymus DNA were investigated after treatment with the pesticides malathion (0,0-dimethyl-S-(1,2-bis ethoxycarbonyl ethyl)dithiophosphate) and DDVP (0,0-dimethyl-0-(2,2 dichlorovinyl)phosphate) in vitro by means of derivative (differential) pulse polarography (DPP), thermal denaturation curves recorded spectrophotometrically (Tm), viscometric measurements, and chromatography on the hydroxyapatite column. Changes in the properties of DNA were observed by means of DPP after only a few hours incubation with the pesticides, whereas the other methods did not detect any changes even after 48 h. The results obtained by DPP indicate that single-stranded segments and thermolabile regions are formed in DNA due to the action of the pesticides. This behaviour could perhaps be a consequence of guanine alkylation followed by depurination and chain scission at elevated temperatures. Malathion and DDVP differ in the kinetics of reaction with double-helical DNA. DDVP is more reactive and its action is also manifested after 72 h in changes in viscosity, Tm, and chromatographic behaviour on the hydroxyapatite column. The changes induced by malathion were, under identical conditions, not detectable by these methods.

Animals↗
PubMedDate not supplied

The influence of cysteine on the reaction of d-guanosine with cis-diamminedichloroplatinum (II).

Mono- and bifunctional complexes of cis DDP and d-guanosine were isolated on Sephadex G-25. The presence of cysteine in incubation mixture resulted in the vanishing of bifunctional complex of d-guanosine and the appearance of d-guanosine-cis DDP-cysteine complex in the eluted peak. It is also possible that the eluted peak contained no homogeneous product of the reaction.

Chemical Phenomena↗
PubMedDate not supplied

Estimation of the extent of DNA platination after interaction of cis-DDP with DNA and chromatin.

The aim of this work was to compare the kinetics of platinum binding to "naked" DNA and DNA remaining in a nucleoprotein complex. The incubation of chromatin and DNA from calf thymus was carried out with cis-DDP at different concentrations and incubation times. The coefficient rb/mumolPT/mumolDNA/ of platinum binding to DNA was determined and the kinetics of cis-DDP binding to particular preparations was found and compared. The presence of chromosomal proteins decreases the extent of DNA platination. Hence it can be suggested that this drug induces the process of chromatin aggregation and condensation which in turn reduce the release of the total pool of DNA.

Animals↗
PubMedDate not supplied

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex.

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.

Animals↗
PubMedDate not supplied

Induction of DNA-protein cross-links by platinum compounds.

The differences between cis- and trans-diamminedichloroplatinum II (DDP) in forming DNA-protein cross-links in isolated human lymphocytes were investigated. Both cis- and trans-DDP can induce DNA-protein cross-links. We show that cis-DDP forms complexes between DNA and proteins faster than trans-DDP. This results from an increase in the quantity of DNA and platinum together with an increase in drug concentration. Under the same conditions trans-DDP causes a decrease in DNA-forming complexes with proteins. After a 12 h incubation of lymphocytes we observe a similar level of DNA in DNA-protein cross-links induced by DDP isomers, but more platinum appears in complexes induced by trans-DDP. The results obtained demonstrate that the antitumor drug - cis-DDP and the clinically ineffective trans-DDP induce links between DNA and proteins in a different manner. We suggest that the therapeutic activity of cis-DDP can in part arise from rapidly forming DNA-protein complexes which can destroy the most important cellular processes, such as replication and transcription.

Blood Proteins↗