PubMed · 8743312
The source did not provide an abstract. Follow the original record for more information.
Explore connections, maps & timelines
G Galfrè, P Monaci, A Nicosia, A Luzzago, F Felici, R Cortese. 1996. Immunization with phage-displayed mimotopes.. https://doi.org/10.1016/s0076-6879(96)67008-6
Cite the original work for its findings. Save a collection to share your selection of sources.
KEEP EXPLORING
Passive antibody studies unequivocally demonstrate that sterilizing immunity against lentiviruses is obtainable through humoral mechanisms. In this regard, DNA vaccines represent an inexpensive alternative to subunit vaccine for mass vaccination programs designed to induce such responses to human immunodeficiency virus type I (HIV-1). At present, however, this vaccine modality has proven relatively ineffective at inducing humoral responses. In this report, we describe the immunogenicity of DNA vaccines that direct the coincident expression of the cholera toxin catalytic domain (CTA1) with that of the human immunodeficiency virus type I gp120 through genes either encoded in individual plasmids or in a single dicistronic plasmid. In BALB/cJ mice, coincident expression of CTA1 in either a separate plasmid or in the dicistronic plasmid in the DNA vaccines induced serum IgG responses to gp120 that were at least 1000-fold greater, and remained elevated longer than, the analogous responses in mice vaccinated with a DNA vaccine that expressed gp120 alone. In addition, mice vaccinated with CTA1 and gp120 produced significantly more gp120-specific IFN-gamma ELISPOTs than mice vaccinated with the gp120 DNA vaccine. Combined, these data show that the adjuvant properties of cholera toxin can be harnessed in DNA vaccine modalities.
Immunostimulatory oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) stimulate IL-12-dependent Th1 dominated cytokine and enhanced IgG responses when co-delivered with antigen to mice. However, the CpG ODN sequences that are optimal for each mammalian species may differ. Previously, we demonstrated that a CpG ODN containing the GTCGTT motif was optimal for stimulating bovine B cell proliferation, and induced IL-6, IL-12 and IFN-gamma production by peripheral blood mononuclear cells (PBMC). The current study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-gamma-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and antigen-stimulated PBMC from these calves also expressed higher levels of IFN-gamma transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-gamma mediated cellular immune responses in cattle.
Rinderpest is an acute, highly contagious often fatal disease of large and small ruminants, both domestic and wild. Global eradication of rinderpest needs a robust, safe and cost-effective vaccine. The causative agent, rinderpest virus (RPV) is an important member of the genus Morbillivirus in the Paramyxoviridae family. We have generated transgenic peanut (Arachis hypogea L.) plants expressing hemagglutinin protein of RPV and report here, the induction of immune responses in cattle following oral feeding with transgenic leaves expressing hemagglutinin protein without oral adjuvant. Hemagglutinin-specific antibody was detected in the serum as confirmed by immunohistochemical staining of virus-infected cells, and in vitro neutralization of virus infectivity. Oral delivery also resulted in cell-mediated immune responses.