SEARCH · PubMed Health

Results for “shared variables”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 181 records · Page 10Linked to original sources

PubMed1989

Immunoglobulin lambda light-chain-related genes 14.1 and 16.1 are expressed in pre-B cells and may encode the human immunoglobulin omega light-chain protein.

Human pre-B cells, which produce immunoglobulin heavy chain but do not produce immunoglobulin light chain, are shown to contain a 1-kilobase transcript homologous to immunoglobulin lambda light-chain genes. Detailed analysis of RNA and cDNA clones derived from these transcripts reveals that they originate from the distinct immunoglobulin lambda-like genes 14.1/16.1. Sequence analysis of these clones reveals a long open reading frame, beginning with an ATG, capable of encoding a protein of 214 amino acids with an unprocessed molecular weight of 22,944. The C-terminal half of this predicted protein is highly homologous to immunoglobulin lambda light-chain joining and constant region protein sequence, while the amino-terminal end does not share homology with variable regions. Unlike immunoglobulin genes, these genes do not undergo rearrangement prior to expression. Analysis of a panel of 26 hematopoietic cell lines reveals that expression of 14.1/16.1 is limited to pre-B cells and one B-cell line, which, like the pre-B cells, is surface immunoglobulin negative. Antisera raised against a peptide whose sequence was predicted from the 14.1 cDNA sequence identifies a 22-kDa protein in human pre-B cells. Immunoprecipitation of immunoglobulin mu-chain from these pre-B cells with anti-immunoglobulin mu antibody coprecipitates a 22-kDa protein, which is a candidate for the human immunoglobulin omega light-chain protein and may be the protein product of the 14.1/16.1 genes.

Amino Acid Sequence↗

PubMed1998

Alternative splicing of rearranged T cell receptor delta sequences to the constant region of the alpha locus.

The T cell receptor (TCR) alpha/delta locus is composed of a common, shared set of variable (V) and distinct diversity (D), joining (J), and constant (C) genes. It has been recognized for several years that transcripts of the rearranged VDJdelta or VJalpha genes are spliced to the Cdelta or Calpha genes, respectively, encoding distinct TCR delta and alpha proteins. Herein, we describe the discovery of a splicing variation that allows the assembled VDJdelta genes to be fused with the Calpha gene. This variation is prominent in TCRdelta gene-deficient mice but is also detectable in wild-type mice. Furthermore, we show that several in-frame VDJdelta rearrangements in TCRdelta gene-deficient mice are strikingly underrepresented, suggesting that the alternative transcripts, with protein coding capacity, influence the development of alphabeta thymocytes. In-frame TCRgamma gene rearrangements do not appear underrepresented, indicating that the effect is not mediated by the gamma chain. Instead, indirect evidence supports the hypothesis that the delta/alpha chimeric protein acts in conjunction with the TCRbeta chain. These results have implications for the transcriptional control of the TCRalpha/delta locus and provide a novel insight into the distinct functional capacities of the TCR alpha and delta proteins during thymocyte development.

Alternative Splicing↗

PubMed2002

Interpreting reaction time measures in between-group comparisons.

Although reaction time measures have been used extensively in many types of between-group comparisons, the assumptions and limitations of reaction time measurement are not always recognized. In this article we discuss three issues that should be considered when designing and interpreting comparisons involving reaction time. These concern speed-accuracy tradeoffs, methods of analyzing measures postulated to reflect specific processes, and methods for distinguishing group-related influences that are shared with other variables from those that are unique to a single variable.

Confounding Factors, Epidemiologic↗

PubMed2002

Pattern of responses to HIV transmission questions: rethinking HIV knowledge and its relevance to AIDS prejudice.

This paper intends to investigate the connection between HIV transmission knowledge and prejudicial attitudes towards people with HIV/AIDS (PWAs), with an emphasis on exploring the pattern of cognitive profile in response to knowledge questions. Data for the present study were derived from the 'Health Attitudes and Health Seeking Behavior Study', a telephone survey of a nationally representative sample, aged 20 to 70, from April to May 1997 in Taiwan. A total of 2,471 respondents who had heard of AIDS and knew that it was infectious were included in the analysis. Based on answers to four transmission-route items (blood transfusion, mother-foetus, sexual contacts, needle sharing) and two casual-contact items (shaking hands and sharing utensil), a variable 'pattern of knowledge performance' was constructed, by which the respondents were clustered into five knowledge groups. Bivariate and multivariate analyses illustrated the greater explanatory power of pattern of knowledge performance rather than additive scoring of knowledge items to PWAs' prejudice. Moreover, it was the responses to casual-contact rather than transmission-route questions that made a greater contribution to PWAs' prejudice. Special attention is given to the possible perceptual undertaking inherent in the five types of knowledge group. To implement effective AIDS prevention campaigns and interventions, the design for increasing the risk perception of the correct HIV transmission routes should differ from that of reducing the risk perception of the casually transmitted routes.

Adult↗

PubMed1989

Production of sterile transcripts of C gamma genes in an IgM-producing human neoplastic B cell line that switches to IgG-producing cells.

A human neoplastic B cell line SSK41 that expresses IgM on its surface switches spontaneously to IgG-producing cells. The SSK41 line contains a single immunoglobulin heavy-chain locus, the constant region (C) genes of which retain the germline configuration. The IgG-producing SSK41 line was purified by sorting, and shown to have undergone S-S recombination with deletion of the C mu gene. This line produced secretory and membrane-bound forms of gamma-chain mRNA. From cDNA libraries of a mixed population of IgM+/IgG+ SSK41 cells, we have isolated cDNA clones encoding the mature membrane-bound and secretory forms of the mu and gamma 1 heavy chains, all of which share the same variable region sequence. cDNA clones containing the mature gamma 3 chain were identified as well. We also isolated cDNA clones containing C gamma 1 and C gamma 3 sterile transcripts from the SSK41 line. These sterile transcripts contained additional exon sequences designated 'I' which were localized upstream of the C gamma 1 and C gamma 3 switch regions and homologous to murine counterparts. The I sequences were precisely spliced to the 5' ends of the corresponding C gamma exon sequences. These features of germline CH transcripts, i.e. the isotype specificity to class switching, location of exons, and sequences per se, are highly conserved between man and mouse.

Amino Acid Sequence↗

PubMed1984

Supply dependency of oxygen uptake in ARDS: myth or reality?

Several reports state that oxygen uptake changed in direct correlation with changes in total oxygen delivery to the tissues in the adult respiratory distress syndrome (ARDS). Oxygen uptake appeared to be limited by oxygen delivery even at normally adequate levels so that uptake was abnormally dependent on supply. These reports are discussed with respect to whether or not such a result could have been due to errors in measurement or to mathematical coupling by relating two quantities that shared a common variable. Having rejected that proposition, animal experiments are cited in which abnormal oxygen supply dependency was produced by microembolization. The accompanying loss of reactive hyperemia and inability to extract oxygen were consistent with a progressive loss of recruitable capillaries. Evidence is presented that the potential for embolization in ARDS is greatly enhanced by activation of the complement and arachidonic acid cascades as well as by the xanthine oxidase system. The resultant use of molecular oxygen by non-ATP producing oxidase systems might also account for the increase of supply dependent oxygen demand in ARDS.

Animals↗

PubMed1989

Substitution between prescribed and over-the-counter medications.

Using data from the Health Insurance Experiment (HIE), this article examines use of over-the-counter drugs (OTC) in a general, nonelderly population. Families from six areas of the country were assigned to health insurance plans that varied in the amount of medical care cost sharing. Thus, the out-of-pocket prices of OTC relative to prescription drugs were experimentally varied. The sites were chosen to represent markets with differing access to physician services. Multivariate methods were used to relate OTC use (collected from bi-weekly health diaries) to cost sharing and demographic variables. The empirical results do not support the expectation that people assigned less generous insurance for prescription drugs substitute OTC for prescriptions. People with complete insurance coverage purchased more of both types of drugs, suggesting OTC are an adjunct to formal medical care, rather than a substitute for it. Better educated and more knowledgeable consumers used more OTC drugs and spent more of their drug budget on OTC products. That there was greater OTC drug use in HIE sites with poorer access to formal medical care suggests there was some substitution between formal care and self-care with OTC drugs. Overall, however, better financial access to formal care promotes rather than substitutes for OTC use.

Adolescent↗

PubMed2000

Classical teleportation of a quantum Bit

Classical teleportation is defined as a scenario where the sender is given the classical description of an arbitrary quantum state while the receiver simulates any measurement on it. This scenario is shown to be achievable by transmitting only a few classical bits if the sender and receiver initially share local hidden variables. Specifically, a communication of 2.19 bits is sufficient on average for the classical teleportation of a qubit, when restricted to von Neumann measurements. The generalization to positive-operator-valued measurements is also discussed.

Journal Article↗

PubMed2006

Data driven image models through continuous joint alignment.

This paper presents a family of techniques that we call congealing for modeling image classes from data. The idea is to start with a set of images and make them appear as similar as possible by removing variability along the known axes of variation. This technique can be used to eliminate "nuisance" variables such as affine deformations from handwritten digits or unwanted bias fields from magnetic resonance images. In addition to separating and modeling the latent images-i.e., the images without the nuisance variables-we can model the nuisance variables themselves, leading to factorized generative image models. When nuisance variable distributions are shared between classes, one can share the knowledge learned in one task with another task, leading to efficient learning. We demonstrate this process by building a handwritten digit classifier from just a single example of each class. In addition to applications in handwritten character recognition, we describe in detail the application of bias removal from magnetic resonance images. Unlike previous methods, we use a separate, nonparametric model for the intensity values at each pixel. This allows us to leverage the data from the MR images of different patients to remove bias from each other. Only very weak assumptions are made about the distributions of intensity values in the images. In addition to the digit and MR applications, we discuss a number of other uses of congealing and describe experiments about the robustness and consistency of the method.

Algorithms↗

PubMed2002

Sexually antagonistic coevolution in a mating system: combining experimental and comparative approaches to address evolutionary processes.

We combined experimental and comparative techniques to study the evolution of mating behaviors within in a clade of 15 water striders (Gerris spp.). Superfluous multiple mating is costly to females in this group, and consequently there is overt conflict between the sexes over mating. Two alternative hypotheses that could generate interspecific variation in mating behaviors are tested: interspecific variation in optimal female mating rate versus sexually antagonistic coevolution of persistence and resistance traits. These potentially coevolving traits include male grasping and female antigrasping structures that further the interests of one sex over the other during premating struggles. Both processes are known to play a role in observed behavioral variation within species. We used two large sets of experiments to quantify behavioral differences among species, as well as their response to an environmentally (sex-ratio) induced change in optimal female mating rate. Our analysis revealed a large degree of continuous interspecific variation in all 20 quantified behavioral variables. Nevertheless, species shared the same set of behaviors, and each responded in a qualitatively similar fashion to sex-ratio alterations. A remarkably large proportion (> 50%) of all interspecific variation in the magnitude of behaviors, including their response to sex ratio, could be captured by a single multivariate axis. These data suggest tight coevolution of behaviors within a shared mating system. The pattern of correlated evolution was best accounted for by antagonistic coevolution in the relative abilities of each sex to control the outcome of premating struggles. In species where males have a relative advantage, mating activity is high, and the opposite is found in species where females have gained a relative advantage. Our analyses also suggested that evolution has been unconstrained by history, with no consistent evolutionary tendency toward or away from male or female relative advantage.

Analysis of Variance↗

PubMed1990

Cross-reactive idiotypes in sera from patients with leprosy, lupus and Lyme disease and from healthy individuals.

Monoclonal IgM autoantibodies have previously been generated from a patient with lepromatous leprosy. Polyclonal anti-idiotypes raised against two of these monoclonal antibodies (8E7 and TH9) were used in an immunoassay to detect the presence of idiotype in human serum. The anti-idiotypes recognize different but overlapping sets of idiotypic determinants, some of which are present on antibodies which bind to Mycobacterium leprae. Sera were tested from 16 individuals with leprosy, 45 with systemic lupus erythematosus, 20 with Lyme disease, and 80 healthy subjects. Positive sera were detected in all groups (seven, two, three, and four, respectively). In most cases the serum bound to both anti-idiotypes, the idiotype being present in the IgM and/or IgG fraction. Levels of the two idiotypes varied independently of total serum IgG concentration and, in serial samples from one patient, independently of each other. The results indicate that 8E7 and TH9 may be representative of serum antibodies which are commonly expressed in leprosy, but may also be expressed in other diseases and in health; and they suggest that such serum antibodies are encoded by a widely shared set of variable region genes.

Cross Reactions↗

PubMed2005

A probabilistic transmission dynamic model to assess indoor airborne infection risks.

The purpose of this article is to quantify the public health risk associated with inhalation of indoor airborne infection based on a probabilistic transmission dynamic modeling approach. We used the Wells-Riley mathematical model to estimate (1) the CO2 exposure concentrations in indoor environments where cases of inhalation airborne infection occurred based on reported epidemiological data and epidemic curves for influenza and severe acute respiratory syndrome (SARS), (2) the basic reproductive number, R0 (i.e., expected number of secondary cases on the introduction of a single infected individual in a completely susceptible population) and its variability in a shared indoor airspace, and (3) the risk for infection in various scenarios of exposure in a susceptible population for a range of R0. We also employ a standard susceptible-infectious-recovered (SIR) structure to relate Wells-Riley model derived R0 to a transmission parameter to implicate the relationships between indoor carbon dioxide concentration and contact rate. We estimate that a single case of SARS will infect 2.6 secondary cases on average in a population from nosocomial transmission, whereas less than 1 secondary infection was generated per case among school children. We also obtained an estimate of the basic reproductive number for influenza in a commercial airliner: the median value is 10.4. We suggest that improving the building air cleaning rate to lower the critical rebreathed fraction of indoor air can decrease transmission rate. Here, we show that virulence of the organism factors, infectious quantum generation rates (quanta/s by an infected person), and host factors determine the risk for inhalation of indoor airborne infection.

Air Microbiology↗

PubMed1995

Direct production of the Fab fragment derived from the sperm immobilizing antibody using polymerase chain reaction and cDNA expression vectors.

PROBLEM: Sperm immobilizing antibodies cause infertility mainly through complement dependent sperm immobilization. To analyze any effect of sperm immobilizing antibody on fertilization, we had already established cell lines that secrete IgM monoclonal antibody (MAb H6-3C4) and IgG monoclonal antibody (MAb EnBCMGS). The latter was a class-switched recombinant IgG antibody that shares the same variable region as MAb H6-3C4. The biological effects of the IgG antibody were also reported previously to eliminate sperm immobilizing or sperm agglutinating activities. However, the method of chemical digestion of IgG had some disadvantage to prepare the purified Fab fragment stably and in large quantities. This time we report a unique method to obtain the recombinant Fab fragments (Fab EnBCMGS) using polymerase chain reaction (PCR) and cDNA expression vectors. METHOD: Two kinds of PCR primers were designed to make a truncated heavy chain (Fd) gene of MAb EnBCMGS. The amplified Fd gene and light chain gene were ligated into cDNA expression vectors and then transfected into mammalian cells. RESULTS: Expression of the Fd gene and light chain gene were confirmed by Northern blotting. Secretion of the recombinant Fab fragment from mammalian cells was also confirmed by Western blotting. The Fab fragment showed biological activity as is expected by FACS analysis. CONCLUSION: This method enables the stable production of genuine Fab fragments of IgG in mammalian cells without any chemical treatment that may be time consuming and affect the quality of the Fab fragments.

Amino Acid Sequence↗

PubMed2004

Use of genome level-informed PCR as a new investigational approach for analysis of outbreak-associated Mycobacterium tuberculosis isolates.

Mycobacterium tuberculosis strain CH, the index isolate linked to a major tuberculosis outbreak associated with high levels of transmissibility and virulence, was characterized by microarray analysis by use of a PCR product array representative of the genome of M. tuberculosis strain H37Rv. Seven potential genomic deletions were identified in CH, five of which were confirmed by PCR analysis across the predicted deletion points. The panel of five PCRs required to individually interrogate these loci was collectively referred to as the genome level-informed PCR (GLIP) assay. GLIP analysis was performed with CH, 12 other epidemiologically linked isolates, and 43 recent, non-outbreak-associated isolates derived from patients within the local area. All 13 outbreak-linked isolates showed a profile corresponding to the presence of all five deletions. These 13 isolates were also found to share common variable-number tandem repeat and mycobacterial interspersed repetitive unit profiles. None of the 43 non-outbreak-associated isolates exhibited the five-deletion profile. Although three individual deletions were present in upwards of 44% of the non-outbreak-associated isolates, no single-deletion isolates were detected. Interestingly, none of these deletions had been previously recognized, and sequence analysis of the immediate flanking regions in CH failed to identify a likely mechanism of deletion for four of the five loci. The GLIP assay also proved valuable in ongoing surveillance of the outbreak, rapidly identifying a further two outbreak-associated cases months after the initial cluster and, importantly, dismissing a further 12 epidemiologically suspect cases, which allowed the optimum deployment of public health resources.

Base Sequence↗

PubMed1985

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

DNA, Viral↗

PubMed1994

Average case analysis of an Hebb-type rule that finds the network connectivity.

We describe an Hebb-type algorithm for learning unions of nonoverlapping perceptrons with binary weights. Two perceptrons are said to be nonoverlapping if they do not share any input variables. The learning algorithm is able to find both the network architecture and the weight values necessary to represent the target function. Moreover, the algorithm is local, homogeneous, and simple enough to be biologically plausible. We investigate the average behavior of this algorithm as a function of the size of the training set. We find that, as the size of the training set increases, the hypothesis network built by the algorithm "converges" to the target network, both in terms of the number of perceptrons and the connectivity. Moreover, the generalization rate converges exponentially to perfect generalization as a function of the number of training examples. The analytic expressions are in excellent agreement with the numerical simulations. To our knowledge, this is the first average case analysis of an algorithm that finds both the weight values and the network connectivity.

Algorithms↗

PubMed1992

Modification of oxygen extraction ratio by change in oxygen transport in septic shock.

To help clarify the oxygen uptake/transport (VO2/TO2) relationship and because the oxygen extraction ratio (OER) and TO2 share no common variable such as cardiac index, we examined the changes in OER when TO2 was decreased in 12 patients with sepsis in whom a PEEP trial was performed. From zero end-expiratory pressure (ZEEP) to PEEP (12 +/- 3 cm H2O), a significant increase in OER from 30 +/- 10 percent to 38 +/- 12 percent (p less than 0.005) was observed, and individual percentage changes in OER were well correlated with individual percentage changes in TO2. The VO2 measured (VO2m) by respiratory gas analysis was unchanged, while VO2 calculated by the Fick equation (VO2f) decreased, suggesting a mathematical coupling between VO2f and TO2. Patients with hyperlactacidemia (n = 5) exhibited the same relationships between OER, VO2m, and TO2 as those without hyperlactacidemia. Our results suggest an adaptive response in the OER when TO2 is decreased in patients with established septic shock.

Adult↗

PubMed2000

Elimination of Fc receptor-dependent effector functions of a modified IgG4 monoclonal antibody to human CD4.

Several CD4 mAbs have entered the clinic for the treatment of autoimmune diseases or transplant rejection. Most of these mAbs caused CD4 cell depletion, and some were murine mAbs which were further hampered by human anti-mouse Ab responses. To obviate these concerns, a primatized CD4 mAb, clenoliximab, was generated by fusing the V domains of a cynomolgus macaque mAb to human constant regions. The heavy chain constant region is a modified IgG4 containing two single residue substitutions designed to ablate residual Fc receptor binding activity and to stabilize heavy chain dimer formation. This study compares and contrasts the in vitro properties of clenoliximab with its matched IgG1 derivative, keliximab, which shares the same variable regions. Both mAbs show potent inhibition of in vitro T cell responses, lack of binding to complement component C1q, and inability to mediate complement-dependent cytotoxicity. However, clenoliximab shows markedly reduced binding to Fc receptors and therefore does not mediate Ab-dependent cell-mediated cytotoxicity or modulation/loss of CD4 from the surface of T cells, except in the presence of rheumatoid factor or activated monocytes. Thus, clenoliximab retains the key immunomodulatory attributes of keliximab without the liability of strong Fcgamma receptor binding. In initial clinical trials, these properties have translated to a reduced incidence of CD4+ T cell depletion.

Animals↗