SEARCH · PubMed Health
Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Recombinant DNA methods provide highly sensitive means for the detection of DNA alterations that lead to human disease mutations. In this paper I shall illustrate the approaches currently available and discuss new technologies that show promise of replacing the present methods. Medical diagnosis by means of recombinant DNA methods has an expanding role in clinical medicine.
A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X + 3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.
Thirty-six children with growth hormone deficiency were treated for up to 48 months with methionyl human growth hormone (hGH) synthesised by DNA recombinant methods. The growth rate for these children increased from 3.2 +/- 1.1 cm/yr to 10.5 +/- 2.2 cm/yr (mean +/- SD). This was similar to the effect of pituitary hGH in ten GH deficient children, 3.8 +/- 1.0 to 10.1 +/- 1.1 cm/yr. Serum somatomedin C rose from 0.26 +/- 0.23 U/ml to 0.79 +/- 0.53 U/ml after 6 months of methionyl-hGH therapy, similar to the effect of pituitary hGH. The incidence of antibody formation to methionyl-hGH was higher than that observed with pituitary hGH (Kabi) but poor growth was observed only in the one patient on methionyl-hGH who acquired high-titre high-binding-capacity antibodies to hGH. No consistent changes in levels of antibodies to Escherichia coli proteins were detected. No other allergic manifestations or systemic side-effects were demonstrable.
Recombinant DNA technology permits the isolation of libraries of DNA sequences corresponding to either the whole genome of an individual or the expressed sequences of a given cell type. Gene-specific probes isolated from these libraries may be used for the identification of DNA sequences in the genome necessary for normal gene function and for the study of the consequences of mutations and rearrangements in these sequences which give rise to the clinical symptoms in genetic disease. DNA sequence polymorphisms can be used to construct a genetic linkage map of the entire human genome. This allows the development of antenatal diagnoses for monogenic diseases even in the absence of an understanding of the biochemical defect.
Leishmania are usually identified by iso-enzyme analysis. This method works well, but there is a need for an additional, more simple, method of identification. Here we present data that show that in a Southern blot analysis, recombinant DNA probes in combination with certain restriction enzymes can differentiate between taxa of Leishmania. Probes based on clones selected from a L. infantum cDNA library gave characteristic patterns on Southern blots for reference strains of the different types of Leishmania found in Europe, Africa and Asia. Within the different taxa little or no variation was observed. Although the L. infantum derived probes showed a somewhat stronger hybridization for strains of the L. donovani complex, the signal obtained with most probes was satisfactory for L. major, L. aethiopica and L. tropica. Within the L. donovani complex none of the selected probes differentiated between isolates belonging to L. infantum, L. chagasi or L. donovani. Probes containing kinetoplast DNA showed considerable variation in hybridization within a taxon.
Fragment of 1.9 kb recombinant DNA of pDJH2 was linked with vectors pT7-7 and pRSETs. Then they were transformed into E. coli JM109 (DE3) respectively. Expression of subclones was achieved in E. coli JM109 (DE3) with IPTG inducement. SDS-PAGE showed that the molecular weights of products were 68kd and 23 kd respectively. The amount of production seemed to be higher than that of the outer membrane proteins of L. interrogans serovar strain 017 in nature. Immunoblotting of pDJt and pDJrB2 (both are subclones) with the specific antiserum of anti-OMP of L. interrogans serovar lai strain 017 and the experiment of initiative immuno-protection in guinea pigs showed both protein-68 kd and 23 kd might be the antigens of immuno-protection on the outer membrane of L. interrogans serovar lai strain 017.
Explore the source record for details and available documents.
PCR co-amplification of two distinct HIV1 tat gene sequences lead to the formation of recombinant DNA molecules. The frequency of such recombinants, up to 5.4% of all amplified molecules, could be decreased 2.7 fold by a 6 fold increase in Taq DNA polymerase elongation time. Crossover sites mapped essentially to three discrete regions suggesting specific Taq DNA polymerase pause or termination sites. PCR mediated recombination may be a problem when studying heterogeneous genetic material such as RNA viruses, multigene families, or repetitive sequences. This phenomenon can be exploited to create chimeric molecules from related sequences.
Recombinant DNA methodology has greatly increased our knowledge of the molecular pathology of the human genome at the same time as providing the means to diagnose inherited disease as the DNA level. We present here a list of recent reports of both direct and indirect analysis of human inherited disease which is intended to serve as a guide to current molecular genetic approaches to diagnostic medicine.
A recombinant DNA probe with specificity for the 3' end of genomic RNA from the Ark 99 strain of infectious bronchitis virus (IBV) was found to hybridize with extracted RNA of three strains with the Ark serotype, as well as the Mass41, Holl52, Gray, JMK, Conn, Fla and SE17 strains of IBV. Viral infection was detected in the cytoplasm of chicken embryo kidney cells inoculated with Mass41, Ark99, SE17 or two recent field isolates of IBV using in situ cytohybridization and a biotinylated probe. In vivo infections were detected in individual cells of tracheas and lungs 2,4, and 6 days after inoculation of chicks with Mass41 and Ark99. In situ hybridization of Ark99 infected tissue sections using 32P-dATP labelled probe indicated that more viral replication was present in the trachea on day 4 than either days 2 or 6; whereas more viral RNA was found in the lungs on day 6 than days 2 or 4 after inoculation.
Recombinant DNA technology has revolutionized our understanding of many biological systems. However, such techniques and their application have not been fully exploited in the study of sperm zona interaction. Using examples from other biological systems, we ourline several experimental approaches that are likely to significantly enhance our understanding of the gamete recognition process.
Recombinant DNA techniques offer a new approach to the study and eventual genetic manipulation of rumen bacteria to modify the rate and extent of nutrient digestion within the rumen. The foreign genes cloned into a rumen bacterium undoubtedly will have to enhance its ability to compete; otherwise, the new trait will be lost from the highly competitive environment within the rumen. As a general rule, the types of metabolic activities amenable to gene cloning may be those that enhance substrate versatility or eliminate a dependence of a specific rumen bacteria on cross-feeding by other rumen microorganisms. Enhanced substrate diversity and bypassing cross-feeding probably will become more important as the use of highly refined feeds and waste materials from the food and other industries are used in greater quantities to meet the dietary needs of ruminants.
Recombinant DNA technologies now allow the preparation of virtually any polypeptide sequence. Very efficient expression systems for prokaryotic and eukaryotic cells have been developed which may yield large quantities of the desired protein. Bacterial systems are still the most widely used while alternative organisms are often considered when post-translational modifications could influence the biological behaviour of the product. For hirudin or its analogues, two important molecular characteristics should be taken into account. First, it is necessary that no extra amino acid residue, such as the initial methionine, is present on the NH2 end of the recombinant polypeptide. It is known that a free N-terminal sequence is crucial for the thrombin inhibitory activity. Second, a sulphate group on tyrosine at position 63 is found in natural hirudin extracted from leeches. Such post-translational modification has never been observed for all the recombinant hirudin preparations reported to date even though the importance of the sulphate group on the in vitro and in vivo activity of hirudin has not yet been clarified. Finally, the recombinant DNA methodology of choice for the commercial development of hirudin must also take into consideration yield and cost factors which ultimately will affect the widespread use of this product particularly if it has to compete with heparin. We will review our work on the preparation of recombinant hirudin describing bacterial and insect cell expression systems and addressing some of the questions mentioned above.
A variety of recombinant DNA molecules were constructed in which an avian retroviral long terminal repeat (LTR) was ligated to the bovine growth hormone (bGH) gene. The retroviral LTR was derived from a plasmid clone of a Schmidt Ruppin B strain of Rous sarcoma virus while the bGH gene was subcloned from a lambda bacteriophage genomic library. Using a transient eukaryotic expression assay system, recombinant plasmid constructs were screened for their ability to direct expression and secretion of bGH. One such plasmid DNA construct, termed pBGH-4, was found to be active in the production of bGH. Stable mouse fibroblast cell lines were generated containing pBGH-4 DNA integrated into the mouse cell genome. Many of these mouse cell lines express and secrete bGH. One line, L-Pd lambda-BGH4-13, was found to secrete bGH at a rate of 75 micrograms per 5 X 10(6) cells per 24 hr. Bovine growth hormone derived from this cell line is biologically active.
Recombinant DNA technology is a method depending on realization of genetic recombination events artificially. It became possible to obtain any ordered gene or its product with this method. Before production step, ordered gene is derived from original chromosome by endonuclease enzyme and integrated to a vector as a plasmid or a phage. After that this vector is transformed into a bacterium or a yeast. Then ordered gene or protein is produced in desired amounts by culturing these microorganisms.
The emergence of the Epoetin alfa as an effective therapy in the treatment of the anemia of chronic renal failure has reemphasized the importance of nursing monitoring and intervention in the treatment of these patients. This article examines the role of nurses in monitoring and managing patients receiving Epoetin alfa and the development of medications, such as Epoetin alfa, with recombinant DNA technology.
Two new glycosides have been isolated from the MeOH extract of the stem wood and stem bark of an Ecuadorian plant Chamaedorea linearis, and their structures have been determined by spectroscopic means and X-ray analysis of the aglycone to be 1-O-[beta-L-fucopyranosyl-(4'-sulfate)]-25R,5 alpha-spirostane-1 beta, 3 beta-diol [1]) and 1-O-[beta-L-fucopyranosyl-(4'-sulfate)]-25R,5 alpha-spirostane-1 alpha, 3 beta-diol [2]. These compounds were identified in a screen for inhibitors of recombinational DNA repair. Cytotoxic activity was also demonstrated.
Explore the source record for details and available documents.