SEARCH · PubMed Health

Results for “Simple repeated sequences”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 361 records · Page 20Linked to original sources

PubMed1995

Hypervariable microsatellites provide a general source of polymorphic DNA markers for the chloroplast genome.

BACKGROUND: The study of plant populations is greatly facilitated by the deployment of chloroplast DNA markers. Asymmetric inheritance, lower effective population sizes and perceived lower mutation rates indicate that the chloroplast genome may have different patterns of genetic diversity compared to nuclear genomes. Convenient assays that would allow intraspecific chloroplast variability to be detected are required. RESULTS: Eukaryote nuclear genomes contain ubiquitous simple sequence repeat (microsatellite) loci that are highly polymorphic in length; these polymorphisms can be rapidly typed by the polymerase chain reaction (PCR). Using primers flanking simple mononucleotide repeat motifs in the chloroplast DNA of annual and perennial soybean species, we demonstrate that microsatellites in the chloroplast genome also exhibit length variation, and that this polymorphism is due to changes in the repeat region. Furthermore, we have observed a nonrandom geographic distribution of variations at these loci, and have examined the number and location of such repeats within the chloroplast genomes of other species. CONCLUSIONS: PCR-based analysis of mononucleotide repeats may be used to detect both intraspecific and interspecific variability in the chloroplast genomes of seed plants. The analysis of polymorphic microsatellites thus provides an important experimental tool to examine a range of issues in plant genetics.

Base Sequence↗

PubMed1996

Microsatellites: evolution and mutational processes.

Microsatellites (simple sequence repeats) are ubiquitous in eukaryotic genomes, and they are highly polymorphic. They are currently the primary tools for most genetic mapping and for studies comparing the differentiation of human and other mammalian populations. More and more inherited human diseases are now recognized as resulting from mutations in particular microsatellites, and such microsatellite mutations can serve as markers for some cancers. The majority of microsatellite mutational changes probably consist of insertion or deletion of one or a few repeat units through replication slippage, whereas larger (much rarer) changes are important in producing observed allele distributions. Comparisons of microsatellite allele frequencies between humans and chimpanzees suggest that there are constraints on the overall length of microsatellites. Sequence analyses of microsatellites in diverse human and non-human populations indicate that the structure of many repeats may not be as simple as previously believed, in that alleles differ in base composition as well as in repeat length. Single base changes that result in long uninterrupted repeats may lead to increased mutation rates, including the extreme trinucleotide repeat instability responsible for several inherited diseases.

Animals↗

PubMed1993

Vb6 T-cell receptor elements in artiodactyls: conservation and germline polymorphisms.

By use of primers specific for human T-cell receptor (Tcr) Vb6 gene elements, a typing system for Tcr Vb variability in several artiodactyl species has been established. The amplified polymorphic locus is homologous to the human Vb6 gene element. Like the human counterpart, the artiodactyl Vb6 element contains a polymorphic intronic simple (gt)n repeat stretch. Extensive length polymorphism of this simple repeat sequence in some artiodactyls should allow efficient association studies in a multiplex approach, especially including MHC class II genes. On the protein level the Vb regions display little variability in the inter-species comparison among artiodactyls. The amino acid substitutions are not concentrated in the putative complementarity determining regions, suggesting evolutionary conservation. In addition, the simple repetitive element has been preserved in the same genomic location for more than 7 x 10(7) years. Similar evolutionary persistence has already been demonstrated for a (gt)n(ga)m repeat stretch in the second intron of the MHC-DRB locus. The reasons for these parallel developments in evolution are so far not clear, but they may point to a biological meaning if not function of the intronic simple repeat element.

Amino Acid Sequence↗

PubMed1983

Superhelicity induces hypersensitivity of a human polypyrimidine . polypurine DNA sequence in the human alpha 2-alpha 1 globin intergenic region to S1 nuclease digestion--high resolution mapping of the clustered cleavage sites.

Supercoiled recombinant DNAs containing the human adult alpha-globin gene region have been probed with nuclease S1 in vitro. While agarose gel electrophoresis showed only one predominant, double-stranded cleavage generated by S1 within 6 kb of human DNA and 4 kb of pBR322 sequence, a high resolution gel analysis reveals that the unique S1-hypersensitive locus in the human adult alpha-globin gene region actually contains more than 15 authentic S1 cleavage sites closely spaced together. The mapping approach used here locates the specific S1 cleavage sites on both DNA strands at the nucleotide sequence level. Interestingly, most of these sites are mapped within a 90 bp stretch of GC-rich (66%) polypyrimidine . polypurine DNA that is located 1060 to 1150 bp upstream from alpha 1-globin gene. These results provide the first high resolution map of double-stranded S1-cleavage sites induced within a specific DNA sequence under supercoil strain. The distribution and relative cutting frequencies of these sites mapped are consistent with a slippage mechanism in which the simple repeating sequences are organized into base-mismatched duplex on supercoiled DNA.

Base Composition↗

PubMed1988

Primary structure of non-histone protein HMG1 revealed by the nucleotide sequence.

The isolation and sequencing of a cDNA clone coding for the entire sequence of pig thymus non-histone protein HMG1 are described. The sequence analysis reveals a complete 2192-nucleotide sequence with a 5'-terminal untranslated region of 11 nucleotides, 642 nucleotides of an open reading frame that encoded 214 amino acids, and a 3'-terminal untranslated region of 1539 nucleotides. The HMG1 protein, deduced from the nucleotide sequence, has a molecular weight of 24,785 and a C-terminal of a continuous run of 30 acidic amino acids, encoded by a simple repeating sequence of (GAN)30. The predicted amino acid sequence is homologous to HMG1, HMG2, and HMG-T sequences from several sources, suggesting that the protein conformation is under evolutionary constraints. Northern blot analysis reveals that another hybridizable RNA species of smaller size is present. Southern blot analyses suggest that pig genome contains several HMG1 gene equivalents.

Amino Acid Sequence↗

PubMed2000

Pooled genotyping of microsatellite markers in parent-offspring trios.

We studied the extent to which genotyping of simple sequence repeat polymorphisms (SSRs) in pooled DNA samples can be used to predict differences in allele frequencies between parents and their affected offspring. We also developed a simple method of correction for the effects of stutter and differential amplification on the analysis of SSRs in pooled DNA samples based on widely available software. We genotyped individually eight polymorphic microsatellite markers in 110 parent-offspring trios affected with bipolar affective disorder (BP). Analysis of pooled DNA samples predicted very accurately the differences in individual allele frequency distributions between children and their parents. The mean error was <1% (range 0%-3.2%) when marker-specific corrections for stutter and differential amplification were performed. We show that if an individual allele is significantly preferentially transmitted from parents to affected offspring, the difference in the frequency of that allele would be sufficiently large to be detected with pooling in most situations. We propose recommendations for disequilibrium mapping with pooling in which both case-control samples and trios are used in an initial screen and markers are genotyped individually only if they satisfy very relaxed criteria for statistical significance. The use of case-control samples should reduce the false-negative rate as the differences in allele frequencies between cases and controls are twice as high in the presence of the same genetic effect. The use of trios will confirm or reject any suggested differences, thus reducing the false-positive rate that can be created by hidden population stratification.

Bipolar Disorder↗

PubMed1985

Gene structure of a major form of phenobarbital-inducible cytochrome P-450 in rat liver.

The gene structure of cytochrome P-450b, a major form of phenobarbital-inducible cytochrome P-450 in rat livers was elucidated by sequence analysis of the cloned genomic DNAs and was compared with the previously determined gene structures of cytochrome P-450e, a minor form of phenobarbital-inducible cytochrome P-450 and two forms of 3-methylcholanthrene-inducible cytochrome P-450 (P-450c and -d). The gene for cytochrome P-450b is 23 kilobase pairs (kb) long and is separated into 9 exons by 8 intervening sequences. This gene structure is very similar to that of cytochrome P-450e except for the first intron, the first intron being much longer in cytochrome P-450b gene (approximately 12 kb) than in cytochrome P-450e gene (3.2 kb), but differs greatly from the gene structures of two 3-methylcholanthrene-inducible cytochrome P-450s as pointed out previously (Sogawa, K., Gotoh, O., Kawajiri, K. & Fujii-Kuriyama, Y. (1984) Proc. Natl. Acad. Sci. U.S.A. 81, 5066-5070). The nucleotide sequences in all 9 exons and their flanking regions in introns show very close homology between the two phenobarbital-inducible cytochrome P-450 genes. Forty base substitutions are found in approximately 1900 nucleotides of all exonic sequences, and 15 of them result in 14 amino acid replacements. These base substitutions occur in relatively limited regions of the gene sequences. Most of them are found in exons 6, 7, 8, and 9, most frequently in exon 7 as described previously (Mizukami, Y., Sogawa, K., Suwa, Y., Muramatsu, M. & Fujii-Kuriyama, Y. (1983) Proc. Natl. Acad. Sci. U.S.A. 80, 3958-3962). The close sequence homology between the two phenobarbital-inducible cytochrome P-450 genes is also found to extend to the promoter region with one notable exception. The simple repeated sequences of (CA)n which is present at -254 position in cytochrome P-450e gene is also observed at the equivalent position in cytochrome P-450b gene, but the repetitiveness is greatly reduced in cytochrome P-450b gene ((CA)5 for P-450b versus (CA)19 for P-450e), and this may somehow be related to the difference in the level of cytochrome P-450b and P-450e in the inductive phase of phenobarbital administration.

Amino Acid Sequence↗

PubMed2004

Phylogeny and strain typing of Escherichia coli, inferred from variation at mononucleotide repeat loci.

Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria.

Bacterial Typing Techniques↗

PubMed1992

Organization, structure, and function of 95 kb of DNA spanning the murine T-cell receptor C alpha/C delta region.

We have analyzed the organization, structure, and function of the murine T-cell receptor C alpha/C delta region. This region spans 94.6 kb of DNA and contains the C alpha and C delta genes, as well as the V delta 5, J delta 2, and 50 different J alpha gene segments. Within this sequence we have identified 15 new J alpha gene segments, 40 new 5' RNA splice signals, and 40 new DNA rearrangement signals for the J alpha gene segments. The murine C alpha/C delta sequence contains an exceptionally high level of coding sequence with over 5.7% of the total sequence found in the exons. This is much more than that found in the beta-globin locus and the HPRT locus. Using the sequence data obtained from the C alpha/C delta region, we have designed simple assays to test for J alpha gene segment transcription and to determine the level of polymorphism for simple repeat sequences among different inbred strains of mice using the polymerase chain reaction. Furthermore, comparisons of this 95 kb of sequence with the available sequence from homologous regions of other species have led to the identification of a highly conserved sequence that is present throughout vertebrates and in the mouse binds lymphocyte-specific nuclear proteins. Comparisons of a 10-kb region, which includes the C alpha gene in human and mouse, average 66% sequence similarity. These studies support the contention that large-scale DNA sequencing projects of homologous regions of mouse and human will provide powerful new tools for studying the biology and evolution of loci such as the T-cell receptor and for identifying and posing new questions about the functions of conserved sequences.

Amino Acid Sequence↗

PubMed2004

Genomic instability in oral squamous cell carcinoma: relationship to betel-quid chewing.

Genomic instability in repeated DNA sequences is exhibited by a variety of cancer types, including oral squamous cell carcinoma. Exposure to carcinogenic compounds may further increase the instability. We have used Inter-Simple Sequence Repeat (Inter-SSR) PCR methodology to detect genetic alterations in 37 oral cancer patients who had chewed betel-quid. Thirty-eight percent of DNA from tumors had genomic alterations in the sequences flanked by (CA)(8) and (GT)(8) repeats. Patients with tumor DNAs harboring genomic alterations had a two-fold higher consumption of betel-quid than patients without alterations in tumor DNA. Matched normal and tumor DNAs were also screened for microsatellite instability where four patients (10.8%) showed alterations in at least one microsatellite marker but there was no relationship between this phenotype and betel-quid chewing. These data indicate that exposure to carcinogens present in the betel-quid may contribute to genomic instability detected by inter-SSR PCR in a subset of oral tumors.

Adult↗

PubMed1990

Transcription of a satellite DNA on two Y chromosome loops of Drosophila melanogaster.

Primary spermatocyte nuclei of Drosophila melanogaster exhibit three giant lampbrush-like loops formed by the kl-5, kl-3 and ks-1 Y chromosome fertility factors. Detailed mapping of satellite DNA sequences along the Y chromosome has recently shown that AA-GAC satellite repeats are a significant component of the kl-5 and ks-1 loop-forming regions. To determine whether these simple repeated sequences are transcribed on the loop structures we performed a series of DNA-RNA in situ hybridization experiments to fixed loop preparations using as a probe cloned AAGAC repeats. These experiments showed that the probe hybridizes with homologous transcripts specifically associated with the kl-5 and ks-1 loops. These transcripts are detected at all stages of development of these two loops, do not appear to migrate to the cytoplasm and are degraded when loops disintegrate during the first meiotic prophase. Moreover, an examination of the testes revealed that the transcription of the AAGAC sequences is restricted to the loops of primary spermatocytes; the other cell types of D. melanogaster spermatogenesis do not exhibit nuclear or cytoplasmic labeling. These experiments were confirmed by RNA blotting analysis which showed that transcription of the AAGAC sequences occurs in wild-type testes but not in X/O testes. The patterns of hybridization to the RNA blots indicated that the transcripts are highly heterogeneous in size, from large (migration at limiting mobility) to less than 1 kb. We discuss the possible function of the AAGAC satellite transcripts, in the light of the available information on the Y chromosome loops of D. melanogaster.

Animals↗

PubMed1990

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures.

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.

Animals↗

PubMed1998

Characterization of novel minisatellite repeat loci in Atlantic salmon (Salmo salar) and their phylogenetic distribution.

We present here the sequence and characterization of various minisatellite-like tandem repeat loci isolated from the genome of Atlantic salmon (Salmo salar). Their diversity of sequence and lack of core motifs common to minisatellites of other species suggest the presence of numerous and previously unidentified simple sequence repeat families in this salmonid. Evidence for their ubiquity was provided by screening of a salmon genomic library. Southern blot analysis of the phylogenetic distribution of a subset of the minisatellites found one sequence to be pervasive among vertebrates, others present only in Salmoninae or Salmonidae species, and one amplified only in Atlantic salmon. There is evidence for the positioning of microsatellite and minisatellite arrays in close proximity at many loci. Furthermore, one tandem repeat appears to have been inserted into the transposase coding region of a copy of the Tc1 transposon-like element recently identified in salmonids.

Animals↗

PubMed2001

Hypermutability to ionizing radiation in mismatch repair-deficient, Pms2 knockout mice.

DNA mismatch repair (MMR) has been shown to play a role in the cytotoxicity of ionizing radiation (IR), as cell lines established from MMR-deficient mice exhibit higher clonogenic survival after IR than do cell lines from wild-type littermates. To test whether this tolerance phenotype would render MMR-deficient animals hypermutable to IR, we compared IR mutagenesis of Pms2-deficient versus wild-type transgenic mice carrying a lambda shuttle vector for mutation detection. In Pms2 nullizygous animals, the mutation frequency in the supFG1 reporter gene was increased from 210 x 10(-5) in untreated animals to 734 x 10(-5) after 6 Gy of IR (an increase of 524 mutants per 10(5)), whereas the frequency in wild-type mice increased from 1.9 x 10(-5) to 10.2 x 10(-5) (an increase of only 8.3 mutants per 10(5)). Similarly, when the lambda cII gene was used as a reporter, the mutation frequency in nullizygous mice was increased from 16.3 x 10(-5) to 42.3 x 10(-5) after IR (an increase of 26.0 x 10(-5)), whereas the frequency in wild-type mice increased from 2.4 x 10(-5) to 9.4 x 10(-5) (an increase of only 7.0 x 10(-5)). The pattern of IR-induced mutations in the MMR-deficient animals was notable for single bp deletions and insertions in mononucleotide repeat sequences, along with a slight increase in transversions. Overall, these results suggest that MMR-deficiency confers hypermutability to IR, and that much of this hypermutability can be attributed to induced instability of simple sequence repeats. Hence, MMR influences not only the survival but also the mutability of cells in response to IR.

Adenosine Triphosphatases↗

PubMed2000

Evolutionary inventions and continuity of CORE-SINEs in mammals.

We characterized short interspersed elements (SINEs), of the CORE-suprafamily in egg-laying (monotremes), pouched (marsupials) and placental mammals. Five families of these repeats distinguished by the presence of distinct LINE-related 3'-segments shared tRNA-like promoter and the central core region. The putative active elements were reconstructed from the alignment of genomic repeats representing molecular fossils of sequences that amplified in the past and since then underwent multiple mutations. Their mode of proliferation by retroposition was indicated by the presence of: (1) internal RNA PolIII promoter; (2) simple sequence repeated tail; (3) direct repeats; and (4) subfamilies recording the evolution of elements. The copy number of CORE-SINEs in placental genomes was estimated at about 300,000; they were highly divergent and apparently ceased to amplify before radiation of these lineages. On the other hand, among almost half a million fossil elements present in marsupials and monotremes, the youngest subfamilies could still be retropositionally active. CORE-SINEs terminate in sequence repeats of a few nucleotides similar to their 3'-segment LINE-homologues, CR1, L2 and Bov-B. These three LINE elements fall into clades distinct from that of L1 elements which, similar to their co-amplifying SINEs, end in a poly(A) tail. We propose a model in which new CORE-families, with distinct 3'-segments, are created at the RNA level due to template switching between LINE and CORE-RNA during reverse transcription. The proposed mechanism suggests that such an adaptation to the changing amplification machinery facilitated the survival and prosperity of CORE-elements over long evolutionary periods in different lineages.

Animals↗

PubMed1987

Multiple forms of male-specific simple repetitive sequences in the genus Mus.

Previous reports indicate that in laboratory strains of mice, males are distinct from females in possession of repetitive DNA, notably devoid of Eco RI and Hae III sites and rich in the simple tetranucleotides GATA/GACA. We report here that such sequences originated in an ancestor common to laboratory mice, Mus hortulanus, M. spretus, and possibly also M. cookii. Interestingly, other male-specific satellite sequences were detected in M. caroli, M. cookii, M. saxicola, and M. minutoides. This novel satellite is also likely to be composed of simple repetitious sequences, but does not contain GATA and GACA. Thus, the Y chromosome appears to contain a disproportionately large amount of simple repetitious DNA. An attractive explanation for these results is that long tandem arrays of simple repeated sequences are generated at high frequency throughout the genome and that they are retained for a longer time on the Y chromosome due to the absence of homologous pairing at meiosis.

Animals↗

PubMed1996

Sensitivity, reproducibility, and accuracy in short tandem repeat genotyping using capillary array electrophoresis.

The Human Genome Initiative has increased significantly the rate at which disease-causing genes are being mapped and sequenced. New cost-effective methods to locate the genes and to characterize disease-causing mutations require robust, reproducible, and accurate protocols for measuring DNA fragment lengths. Capillary array electrophoresis (CAE) offers rapid, high-resolution separations, high throughput, and sensitive detection. To assess the utility of CAE for the accumulation of genetic information, we tested both sizing accuracy and reproducibility using 48-capillary prototype systems. Two multiplex PCR allelic ladder standards and several CA-repeat markers were analyzed in > 100 runs. Reproducibility in typing > 8000 genotypes reveals a standard deviation of less than 0.2 bp on these systems under optimized conditions. However, sequence-dependent migration anomalies were observed at most simple sequence loci even when analyzed under denaturing conditions, resulting in a systematic bias in estimated fragment sizes. We show here that, by normalizing results to known typing controls, one can obtain locus-averaged accuracies of < 0.06 bp and normalized results within 1 bp of actual. We detect as little as a 1:30,000 dilution of a DNA quantitation standard stained with highly sensitive intercalating dyes, indicating an 80-zeptomole sensitivity limit. However, to obtain reproducible electrokinetic injection, approximately 200 attomoles of fluorescein-labeled DNA is required. These sensitivity limits, sizing precision, and accuracy, together with the 1-hr run times for 48-96 samples, indicate that CAE is a viable method for high-throughput genetic analysis of simple sequence repeat polymorphisms.

Capillary Action↗

PubMed2006

Extensive macrosynteny between Medicago truncatula and Lens culinaris ssp. culinaris.

The first predominantly gene-based genetic linkage map of lentil (Lens culinaris ssp. culinaris) was constructed using an F5 population developed from a cross between the cultivars Digger (ILL5722) and Northfield (ILL5588) using 79 intron-targeted amplified polymorphic (ITAP) and 18 genomic simple sequence repeat (SSR) markers. Linkage analysis revealed seven linkage groups (LGs) comprised of 5-25 markers that varied in length from 80.2 to 274.6 cM. The genome map spanned a total length of 928.4 cM. Clear evidence of a simple and direct macrosyntenic relationship between lentil and Medicago truncatula was observed. Sixty-six out of the 71 gene-based markers, which were previously assigned to M. truncatula genetic and physical maps, were found in regions syntenic between the Lens c. ssp. culinaris and M. truncatula genomes. However, there was evidence of moderate chromosomal rearrangements which may account for the difference in chromosome numbers between these two legume species. Eighteen common SSR markers were used to connect the current map with the most comprehensive and recent map that exists for lentil, providing the syntenic context of four important domestication traits. The composite map presented, anchored with orthologous markers mapped in M. truncatula, provides a strong foundation for the future use of genomic and genetic information in lentil genetic analysis and breeding.

Chromosome Mapping↗